En este momento estás viendo LAS POTENCIAS SATÁNICAS DE ALTO RANGO A PUNTO DE DOMINAR EL MUNDO. Y además LA GLORIA DE DIOS SE MANIFIESTA EN ESE HOY 21-05-22 y de regalo Radio ESE emisión nº 127. 3ª parte
video

 

LASPOTENCIASSATÁNICASDEALTORANGOAPUNTODEDOMINARELMUNDO.mp4 (24 descargas)

 

https://pateitv.com/watch/UdzOcjMxZiznf8C

 

https://archive.org/details/las-potencias-sata-nicas-de-alto-rango-a-punto-de-dominar-el-mundo

 

https://elsecretodelasestrellas.wordpress.com/

LA GLORIA DE DIOS SE MANIFIESTA EN ESE

HOY 21-05-22

ALEJANDRO

QUERIDO JOSE AMIGO DEL ALMA

 

SABES QUE NO HACE FALTA QUE ME PIDAS DISCULPAS, TE QUIERO MUCHO A TAL PUNTO QUE TE HE CONTADO COSAS QUE SOLO TU SABES, SOBRE TODO PARA QUE SUPIERAS QUE SOY EL MENOS MERECEDOR DE LA MISERICORDIA DE DIOS.

PERO ÉL ES SOBERANO, Y QUISO HACERLO ASÍ.

 

CREO QUE EL ESPÍRITU SANTO TABIEN ESTARÁ CONTENTO CON TUS DISCULPAS.

 

CREO QUE COMENTÉ EN EL SECRETO DE LAS ESTRELLAS O A TI, QUE VI LA TRIBULACION EN EL ESPÍRITU.

 

Y ES REALMENTE ESPANTOSA Y PREFIERO NO COMENTAR DETALLES.

 

LO QUE HA SUFRIDO JESUS COMO MINIMO LOS MORADORES DE LA TIERRA SUFRIRAN LO MISMO O MAS.

 

Y LES VOY A CONTAR LO QUE VA A PASAR CON MUCHOS QUE HOY SE VENDIERON AL PODER ECONÓMICO, PERIODISTAS, POLITICOS, ARTISTAS, TODO POR DINERO O POR UNA POSICION SOCIO ECONÓMICA EXCELENTE.

 

EN LA TRIBULACIÓN Y GRAN TRIBULACION, VAN A DESCUBRIR QUE SU ELECCIÓN, NO SIRVIÓ DE NADA, QUE FUE ERRÓNEA.

EL DINERO, LAS PROPIEDADES, EL «PODER SOCIAL» NO LES VA A SERVIR DE NADA.

 

Y QUE AQUELLOS CONOCIDOS QUE FUERON ARREBATADOS ANTES Y NO VIVIERON TODAS LAS COSAS QUE ELLOS VIVIRÁN, ESTABAN EN LO CIERTO.

 

MUCHOS VAN A QUERER ARREGLAR LAS COSAS CON DIOS, Y DIOS CON SU INMENSA MISERICORDIA  LOS VA A PERDONAR.

OTROS LO VAN A MALDECIR, Y SU SUFRIMIENTO VA A SER PEOR AUN

 

VA A SER UN PERIODO TAN DURO DE PASAR Y DE VIVIR, QUE A MUCHOS  LA CONCIENCIA LES HARÁ ARREPENTIRSE Y SEGURAMENTE POR ESO ES EL GRAN AVIVAMIENTO.

 

AUNQUE PARA UNO ES DIFICIL VER COMO SERA POSIBLE QUE CAMBIEN, PARA DIOS ES ALGO MUY SENCILLO.

 

PORQUE PARA DIOS, SU ENEMIGO ES EL DIABLO Y SU ARMA EL PECADO.

Y PARA EL HOMBRE ES EL MISMO ENEMIGO.

 

POR ESO DIOS NOS REGALA LA SALVACION, NO SOMOS SUS ENEMIGOS, SOMOS SU CREACION AMADA.

 

Y ESTOY CONVENCIDO QUE SE PERDERAN LOS 500 MILLONES QUE HABLA LAS PIEDRAS DE GEORGIA.

 

Y HAY UNA MALA INTERPRETACION EN ALGUNOS DE

 

Mateo 22:14

Reina-Valera 1960

14 Porque muchos son llamados, y pocos escogidos.

 

ESA COMA QUE SEPARA LA ESCRITURA ES FUNDAMENTAL PARA ENTENDER LO QUE QUIERE DECIR.

 

MUCHOS SON LLAMADOS A LA CRUZ DE CRISTO, Y CREEN EN ÉL, COMO SU SEÑOR Y SALVADOR.

INDEPENDIENTEMENTE, SI ESTAN EN UNA RELIGION ENGAÑADOS, EL JUICIO NO CAERÁ SOBRE ELLOS SINO SOBRE LOS MENTIROSOS.

 

DIOS CONOCE QUIEN ES DE MENTE Y CORAZON SALUDABLE Y QUIEN NO.

DE ALGUNA MANERA LOS VA A SALVAR Y NO SE VAN A PERDER.

 

POR ESO NOS VAMOS A SORPRENDER ALLÁ ARRIBA Y CUANDO VEAMOS A ALGUNOS, DAREMOS GLORIA A DIOS, PORQUE LO QUE PARA NOSOTROS ERA IMPOSIBLE, DIOS LO HIZO.

 

MUCHOS SE VAN A SALVAR, PORQUE MUCHOS SON LOS LLAMADOS.

 

PERO POCOS DE ESOS LLAMADOS SON LOS ESCOGIDOS.

 

¿A QUIENES SE REFIERE?

 

A LOS QUE FUERON CAPACES Y VALIENTES DE PAGAR EL PRECIO DE SEGUIR A CRISTO, AUN A COSTA DE SU VIDA.

 

A LOS QUE VERDADERAMENTE VAN A PARTICIPAR DE LA BODA DEL CORDERO.

 

A LOS QUE GUARDARON SUS MANDAMIENTOS, Y SOBRE TODO EL MANDAMIENTO DE IR Y PREDICAR SU EVANGELIO Y HACER DISCIPULOS.

 

A LOS QUE HAN OBEDECIDO LAZ VOZ DEL ESPIRITU SANTO

 

A LOS QUE BUSCAN Y LUCHAN POR TENER SANTIDAD A DIARIO.

 

A LOS QUE HACEN LAS BUENAS OBRAS QUE DIOS NOS PREDESTINÓ DESDE EL PRINCIPIO DEL MUNDO.

 

ESOS, (LOS ESCOGIDOS), RECIBIRÁN EL CORAZÓN Y LA MENTE DE CRISTO, ESOS SERÁN REYES Y SACERDOTES, ESOS COGOBERNARÁN CON CRISTO.

 

ESOS CONOCERAN TODOS LOS SECRETOS Y MISTERIOS.

 

ESOS SERÁN UNO CON JESUCRISTO Y UNO CON EL SANTO PADRE Y UNO CON EL ESPIRITU SANTO.

 

ESOS TENDRÁN UN LUGAR DE PRIVILEGIO EN EL REINO DE LOS CIELOS, PERO TENDRÁN A SU VEZ MUCHAS REPONSABILIDADES.

 

EL RESTO TENDRÁN VIDA ETERNA, SERAN SALVOS, VIVIRÁN FELICES Y ADORARÁN AL DIOS ETERNO.

 

LO  VIMOS CON EL PUEBLO HEBREO EN EL DESIERTO COMO DIOS ORGANIZÓ A TRAVES DE MOISES.

EL MISMO ORDEN, CASI UNA REPLICA EXACTA.

 

12 TRIBUS, JEFES POR CADA TRIBU,

UN CACIQUE O MANDAMÁS, MOISES Y LUEGO LOSUE

 

Y UN CONSEJO DE JEFES CUANDO TENÍAN QUE TOMAR UNA DETERMINACIÓN DE GUERRA. O PROBLEMA SOCIAL.

 

EN LA NUEVA JERUSALEN HAY 12 PUERTAS CON LOS NOMBRES DE CADA TRIBU, (HIJOS DE ISRAEL) ¿VEN LA RELACION?

 

SEGUN MIS HERMANOS JUDIOS, PERTENEZCO A LA TRIBU DE YOSEF,  PORQUE LA PARASHA (ROLLO DE LAS SAGRADAS ESCRITURAS QUE SE LEEN EN LOS SHABAT) ME CORREPONDE CUANDO HABLA DE LA VIDA DE JOSE EL GOBERNADOR DE EGIPTO.

 

QUE TREMENDA ENSEÑANZA NOS DA CON SU PUEBLO EN EL DESIERTO Y EN LA TIERRA PROMETIDA, Y COMO NOS AVISA QUE EN EL FUTURO TENDREMOS ESA DEPENDENCIA Y ESE AMOR COMO DIOS QUISO QUE LO TUVIERA ESE PUEBLO.

 

YA ESCRIBI DEMASIADO, MIS QUERIDOS HERMANOS EN CRISTO, LOS SALUDOS CON LA PAZ Y EL AMOR DE NUESTRO SEÑOR JESUCRISTO,  Y SEA CON TODOS USTEDES.

 

ME HICE PROPIO ESTE SALUDO DE  LOS APOSTOLES, PORQUE ME HACE SENTIR MUY BIEN, DESEÁRSELOS Y DECÍRSELOS.

 

LKM

 

DIOS ME LOS BENDIGA

 

JOSÉ DE ESE

 

QUERIDO ALEJANDRO FÍJATE EN ESTO.

ERES DE LA TRIBU DE JOSÉ, EL GOBERNADOR DE EGIPTO, TUS AMIGOS JUDÍOS TE LLAMAN JAJAM, (EL SABIO) AUNQUE A TI NO TE GUSTA QUE TE LLAMEMOS ASÍ,  Y AHORA ESTÁS EN ESE CON SU NOTARIO JOSÉ.

ES FANTÁSTICO, ¿NO TE PARECE?

POR CIERTO EN 68 AÑOS DE VIDA JAMÁS ENTENDÍ MATEO 22-14. MUCHOS SON LOS LLAMADOS Y MUY POCOS LOS ESCOGIDOS.

 

LOS ESCOGIDOS SOMOS NOSOTROS LOS DEL ARREBATAMIENTO. ME PARECE QUE TU PRESENCIA EN ESE ES SOBRENATURAL.

UN GRAN ABRAZO

 

 

ALEJANDRO

 

NO HACÍA FALTA QUE TE DISCULPARAS QUERIDO AMIGO, SABES QUE TE QUIERO MUCHO Y TE DIJE QUE OPINIÓN TENGO DE TI, Y SI A EL ESPÍRITU SANTO QUE SEGURO ESTARÁ CONTENTO POR TI.

 

CON RESPECTO AL ARREBATAMIENTO DICEN QUE ES EL 15 DE MAYO 18 HORAS DE ISRAEL, POR ESO ES 15 O 16 DE MAYO.

 

PORQUE ADEMÁS DE LA PASCUA TARDÍA EL 15 DE MAYO ES LA COSECHA DEL TRIGO, MIENTRAS QUE EN LA PASCUA HACE UN MES ATRÁS FUE DE LA CEBADA.

 

PERO HAY 3 FECHAS POSTERIORES, UNA SOLO LA DIGO YO, EL RESTO LO DICEN OTROS.

 

EL 27 DE MAYO DE 2022, SE CUMPLEN LOS 40 DÍAS QUE ESTUVO JESÚS DESPUÉS DE SU RESURRECCIÓN, TOMANDO EN CUENTA EL DIA QUE SE CONMEMORÓ ESTE AÑO Y FUE EL ASCENSO, QUIZAS ESE DIA SERA NUESTRO ASCENSO, ¿QUIEN LO SABE?

 

OTROS LUGARES DAN DOS FECHAS SIGUIENTES

UNA EL 5 O 6 DE JUNIO NO  RECUERDO BIEN QUÉ ES PENTECOSTÉS, EL DÍA QUE DESCENDIÓ EL ESPÍRITU SANTO Y COMENZÓ SU MINISTERIO.

 

EL OTRO UNA FECHA QUE RECIBIÓ UN HERMANO DE UN ESTUDIO NUMÉRICO QUE LE REVELÓ DIOS.  BASTANTE INTERESANTE

 

DICE QUE EL DIA DEL ARREBATAMIENTO QUE RECIBIÓ Y LE EXPLICO EL ESPÍRITU SANTO PORQUE ERA ESE DIA ES

 

EL 27 DE SEPTIEMBRE DE 2022 HORA 18 DE ISRAEL, FIESTA DE LAS TROMPETAS.

 

LO CURIOSO DE ESTO ES

 

DIA 27= 2+7=9

MES SETIEMBRE=9

HORA ISRAEL 18=1+8=9

 

DIA + MES+HORA= 9 9 9

 

AL REVÉS DE 6 6 6

 

MUY CURIOSO

 

EL HERMANO ASEGURA QUE FUE MENSAJE DEL ESPÍRITU SANTO, QUE NO SE LE HUBIESE OCURRIDO NUNCA..

 

DICE QUE LE DIJO

 

SI CONOCES LA RELACIÓN DE LOS NÚMEROS, SABRÁS LOS TIEMPOS.

 

Y TOMÓ VERSÍCULOS COMO BASE MATEO 24

 

VEREMOS, PERO NO PASAMOS MUCHO TIEMPO MÁS, ESTO SE ESTA PONIENDO CADA VEZ MÁS OSCURO Y ES PORQUE LAS TINIEBLAS SE ACERCAN

 

TKM

 

Susana Morales

El Dios de Israel, el Dios de los  Cristianos,  el Dios Musulmán, el Dios del Universo JEHOVÁ,  YHVH,  ALLAH, siempre es el mismo DIOS porque  hay uno sólo  ÉL ES NUESTRO PADRE CELESTIAL.

 

José de ESE

Pero querida Susana, si eso fuera así Bergoglio tendría razón al unificar las religiones y la muerte de Cristo en la cruz no habría servido para nada. No estoy de acuerdo con tu reflexión.

Esto es anatema, falso y lleva a la condenación eterna porque va en contra de la palabra de Cristo cuando dice Yo Soy el Camino la Verdad y la Vida.

 

Susana Morales

Tú  sabes que yo tuve mi propia experiencia hace años cuando fallecí clínicamente. Escuchaba las palabras del médico  que gritaba la perdí  se me fue y ahí  hice el viaje al más  allá y me encontré con Él y me regresó.

Luego estuve tres días  en CTI  esos tres días  estuvo a mi lado sólo  yo lo veía al tercer día  me pasaron a intermedio y ya no lo vi más  pero sentía su presencia.

 

Susana Morales

Hay varias maneras de esclavitud no únicamente la física  sino también la espiritual la cuál  es más  peligrosa que la primera.  Debemos despojarnos de las ataduras terrenales la ambición el egoísmo, la idolatría,  la envidia, la injusticia,  la lujuria, el despotismo, la mentira, el ego y la miseria. Sólo  si nos conservamos lejos de las tentaciones y el pecado podemos conservar una vida de plenitud y libertad para consagrarnos a Dios.

 

Susana Morales

Mira Yosef disculpa si me meto en conversación ajena pero tu respuesta es indignante. A Nuestro Señor Jesucristo lo asesinaron los judíos . El sabía de antemano que lo iban a entregar o tú  eres tan ingenuo o ignorante de pensar que él planeo que la humanidad lo asesinara porque  a ÉL  se le antojo. Que se entregó y dijo azótenme bastante, claven una lanza en mi cuerpo, traigan una cruz que yo cargo con ella y una corona de espina para culminar mi tormento, abro mis brazos y me clavan. Disculpa si sos judío y te ofendo pero esa es la verdad te guste o no .

LOS JUDIOS MATARON A CRISTO CUANDO PILATO PREGUNTO A QUIÉN  SALVABA ELLOS GRITARON A BARRABAS.  CON LA VERDAD NO OFENDO NI TEMO. SI NO TE GUSTA PACIENCIA  Pero a mi Señor no lo sigan manoseando.

 

 

Susana Morales

 

Arturo te lo explico nuevamente no quise hacer el relato largo cuando llegue a la puerta de la Casa del Padre salio un hombre a recibirme le dije que quería hablar con el Padre y él me dijo pase y le conteste que no que lo esperaba en la puerta mirando los jardines sabía  perfectamente si entraba no iba a regresar entonces el hombre se fue y salió Nuestro Señor Jesucristo y él fue que me dijo que volviera. Te la hice corta pero hay mucho más  para contar.

 

 

José de ESE

Queridos hermanos de ESE.

Fijaros en la dirección de YouTube que os dirige a mi canal:

El Secreto de las Estrellas

https://www.youtube.com/user/pituvillar

Si tenéis tiempo echar una ojeada pues hay algunos muy interesantes.

Por cierto he encontrado el vídeo con las 3.795.139 visualizaciones.

Rectifico. El otro día dije que YouTube cambiaba las estadísticas y me robaba dinero y no es cierto. Me equivoqué de vídeo. Pido públicas disculpas.

TEMIBLE REVELACIÓN. ¿Resucitará el Papa Juan Pablo II para ser el anticristo bíblico, la Bestia 666?
Este texto lo escribí y publiqué el 5 de abril de 2014 y pueden leerlo íntegro en la web de «el secreto de las estrellas» en este enlace.
https://elsecretodelasestrellas.wordpress.com/2014/04/05/la-profecia-oculta-en-el-apocalipsis-juan-pablo-ii-resucitara-el-papa-francisco-le-cedera-su-trono-y-asi-sera-tambien-el-octavo-8o-is-666-reza-la-nueva-moneda-nom/

José de ESE

Rectificación.

EGE me ha corregido la cifra de vídeos en ESE.

Salen 286 archivos de vídeo subidos en ESE. Si le sumamos los 624 vídeos de YouTube que conté en ESE nos da un total de 910 vídeos.

Hasta 1.000 faltan 90 vídeos. Si hago 3 por semana faltan 30 semanas, o sea 210 días. Si dividimos por 30 nos da 7 meses. Nos vamos en noviembre del 2022. ¿El arrebatamiento en noviembre 2022?

Como muy tarde antes del 21 de marzo de 2023.

Recordar a las vírgenes prudentes.

 

Yosef Arad

EL «COV1D 19» PROVIENE DE UN ALGORITMO INFORMÁTICO CREADO CON UN PROGRANA LLAMADO «MUSCLE».

SUS SIGLAS EN INGLES SON UN ACRÓNIMO QUE SE DESMIGA ASÍ:

C= CONTROL

O= ORGANIC

V= VERIFICATION

I= IDENTIFYER

D= DEVICE

«19»= 1+9

1= 1@ LETRA DEL ABECEDARIO=A

9= NOVENA LETRA= I

O SEA A.I.= ARTIFICIAL INTELLIGENCE

TRADUCIDO AL CASTELLANO: DISPOSITIVO IDENTIFICADOR  DE. VERIFICACION Y CONTROL ORGANICO.

UNA MANIOBRA MÁS DE DISTRACCIÓN Y DESVIACIÓN DE LA ATENCIÓN PARA CONFUNDIR AL YA DE POR SÍ ATURDIDO E IGNORANTE PERSONAL.

ADEMÁS LO FIRMAN (COMO DE COSTUMBRE):

«EL EMBAJADOR RUSO (EN LA ONU) SEÑALÓ QUE SU PAIS PRETENDE INVOCAR LOS ARTS. 5 Y 6 (5+6=11 LA P1RAMIDE M@$ONIC@ K1LLUM1N4T1) DEL CONVENIO INTERNACIONAL SOBRE ARNAS BIOLOGICAS.

LKM

 

Maria Jesus

PAZ Y BENDICIONES ESTIMADOS HERMAN@S DE ESE, LKM,

* GALATAS 5: 16-26

******LAS OBRAS DE LA CARNE Y EL FRUTO DEL ESPÍRITU ******

DIGO, PUES: ANDAD EN EL ESPÍRITU, Y NO SATISFÁGAIS LOS DESEOS DE LA CARNE.

PORQUE EL DESEO DE LA CARNE ES CONTRA EL ESPÍRITU, Y EL DEL ESPÍRITU ES CONTRA LA CARNE; Y ÉSTOS SE OPONEN ENTRE SÍ, PARA QUE NO HAGÁIS LO QUE QUISIEREIS.

PERO SI SOIS GUIADOS POR EL ESPÍRITU, NO ESTÁIS BAJO LA LEY.

Y MANIFIESTAS SON LAS OBRAS DE LA CARNE, QUE SON: ADULTERIO, FORNICACIÓN, INMUNDICIA, LASCIVIA,

IDOLATRÍA, HECHICERÍAS, ENEMISTADES, PLEITOS, CELOS, IRAS, CONTIENDAS, DISENSIONES, HEREJÍAS, ENVIDIAS, HOMICIDIOS, BORRACHERAS, ORGIAS, Y COSAS SEMEJANTES A ÉSTAS; ACERCA DE LAS CUÁLES OS AMONESTO, COMO YA OS LO HE DICHO ANTES, QUE LOS QUE PRACTICAN TALES COSAS NO HEREDARÁN EL REINO DE DIOS.

MAS EL FRUTO DEL ESPÍRITU ES AMOR, GOZO, PAZ, PACIENCIA, BENIGNIDAD, BONDAD, FE,

MANSEDUNBRE, TEMPLANZA; CONTRA TALES COSAS NO HAY LEY.

PERO LOS QUE SON DE CRISTO HAN CRUCIFICADO LA CARNE CON SUS PASIONES Y DESEOS.

SI VIVIMOS POR EL ESPÍRITU, ANDEMOS TAMBIÉN POR EL ESPÍRITU.

NO NOS HAGAMOS VANAGLORIOSOS,  IRRITÁNDONOS UNOS A OTROS, ENVIDIÁNDONOS UNOS A OTROS.

AMÉN,

NUESTRO SEÑOR JESUCRISTO YESHUA VIENE PRONTO, HALLELUYAH!!

🙏💙🎶🎺🎺🎵🎻🎻

 

Maria Jesus

HOLA ESTIMADO JOSÉ, MUY INTERESANTE EL VIDEO DE HOY, BUENÍSIMO, PERO TE HAS OLVIDADO DE LA BENDICIÓN AARONICA,

BIEN, TENGO ALGUNOS PUNTOS QUE COMENTAR CONTIGO, QUE SON LOS SIGUIENTES,

ME HA GUSTADO MUCHO QUE PIDAS PERDÓN AL ESPÍRITU SANTO,  PORQUE NO DEBEMOS ENTRISTECERLE, CON NUESTRA FALTA DE CONOCIMIENTO, MAS BIEN DEBEMOS PEDIRLE QUE LO AMPLÍE Y NOS DE SABIDURÍA.

 

NO ME PUEDES COMPARAR CON PATAGONIA, PORQUE ELLA ME SUPERA EN MUCHAS COSAS, TIENE CONOCIMIENTOS DE HISTORIA, EN TODAS LAS MATERIAS, TIENE ALMA DE PERIODISTA,  Y YO TENGO POCOS CONOCIMIENTOS Y POCOS ESTUDIOS, PERO LA EXPERIENCIA DE LA VIDA, ES LA  QUE ME HA ENSEÑADO, Y QUE PIDO A NUESTRO SEÑOR QUE AMPLÍE MI CONOCIMIENTO PARA ESTAR MAS PREPARADA, PERO NO TENGO GRANDES MERITOS, NI SIQUIERA ME MANEJO CON INTERNET, PERO ALGO QUE SI TENGO ES INTUICIÓN.

 

EN FIN JOSÉ QUE MAS PUEDO DECIRTE, BUENO SÍ, QUE ESO QUE TU SIENTES,  QUE ESTE MUNDO, O LA GENTE QUE NOS RODEA ESTÁ CADA VEZ MÁS LEJOS, O NOSOTROS ESTAMOS CADA VEZ MÁS LEJOS DE ELLOS, POCO A POCO ESTAMOS HACIENDO UNA TRANSFORMACIÓN A NIVEL EMOCIONAL,  Y ESPIRITUAL, PORQUE NOS ESTAMOS PREPARANDO PARA VOLVER AL LUGAR DEL QUE VINIMOS.

 

POR ESO DICE PABLO: «PERO LOS QUE SON DE CRISTO HAN CRUCIFICADO LA CARNE CON SUS PASIONES Y DESEOS.

SI VIVIMOS POR EL ESPÍRITU, ANDEMOS TAMBIÉN POR EL ESPÍRITU.» GALATAS 5: 24,25.

UN GRAN ABRAZO Y BENDICIONES ESTIMADO, TKM, MARANATHA! 🙏💙

 

ALEJANDRO

 

QUERIDO AMIGO DEL ALMA

 

SEGÚN EL RELOJ DE ISAÍAS, EL ARREBATAMIENTO ES DESPUÉS DE QUE CUMPLE LOS 73 AÑOS ISRAEL Y AL AÑO Y UN POCO MÁS DE TIEMPO

 

ES DECIR AÑO 74 Y ALGO MÁS DE TIEMPO.

 

Y EN LA PARÁBOLA DE LAS VÍRGENES. EL NOVIO SE RETRASA Y LAS VÍRGENES SE DUERMEN.

 

HAY SEGÚN ESTA PARÁBOLA UN PEQUEÑO RETRASO, SUPUESTAMENTE DE HORAS EN LA PARÁBOLA, PERO NO SE CUANTO TIEMPO EN NUESTRO TIEMPO.

 

SUPONGO  QUE ES CORTO TIEMPO POR DEDUCCIÓN QUE DICE LA PARÁBOLA.

 

TAMBIÉN CREO QUE USTEDES MIS HERMANOS NO ESTAN SINTIENDO COMO QUE EL MOMENTO ESTÁ POR LLEGAR.

 

PERO NO SÉ SI SERA PORQUE ESTOY MEDIO MUERTO ESTOY MÁS SENSIBLE, Y ESTOY SINTIENDO QUE EL MOMENTO ESTÁ MUY CERCA DE SER.

 

TENGO DOS FECHAS BÍBLICAS PRÓXIMAS Y LA OTRA ES LEJANA Y NO CREO LLEGAR.

 

LA PRIMERA

 

EL 27 DE MAYO SE CUMPLEN 40 DÍAS DE LA CONMEMORACIÓN DE LA RESURRECCIÓN DE JESUCRISTO

 

DESPUÉS DE LA RESURRECCIÓN  JESÚS ESTUVO 40 DÍAS CON SUS DISCÍPULOS Y LUEGO ASCENDIÓ, FUE ARREBATADO AL CIELO.

 

EL 5 O 6 DE JUNIO ES EL FESTEJO DE PENTECOSTÉS, CUANDO EL ESPÍRITU SANTO COMENZÓ SU MINISTERIO EN LA IGLESIA BAUTIZANDO A LOS 120 PRIMEROS CRISTIANOS, HACIÉNDOLOS NACER DE NUEVO EN EL ESPÍRITU.

 

CREO Y TE MANDE UN MAIL PARA QUE ME INFORMARAS, UNO DE ESOS DÍAS TIENEN PENSADO ACTIVAR EL CERN.

 

SI ESE DÍA OCURRE EL ARREBATAMIENTO LE VAN A ECHAR LA CULPA AL CERN Y NO VAN A SABER PORQUE.

 

SACÁNDOLO DE USO PARA AL FINAL SI CONSIGUEN SU  OBJETIVO DE QUE LES SIRVE EL CERN SI VAN A DOMINAR EL MUNDO IGUAL.

 

LA OTRA FECHA ES DADA POR UN HERMANO POR SUPUESTA E INTERESANTE REVELACIÓN DEL ESPÍRITU SANTO Y SERIA EL  27 DEL 09 DE 2022 A LAS 18 HORAS DE ISRAEL

 

UN DATO MUY PRECISO Y COINCIDENTE CON EL AÑO NUEVO RABINICO

 

Y YOM KIPUR DÍAS DESPUÉS.

 

EL FALSO PROFETA ES MUY POSIBLE QUE SEA UN RABINO QUE CUMPLIO JUSTO ESTE 14 DE MAYO 34 AÑOS Y ES MUY LOADO POR LOS JUDIOS.

 

SEGÚN DICEN SUS PRÉDICAS SON ÚNICAS Y ESTE SI DICE AQUEL ES EL MESÍAS, LA COLECTIVIDAD RELIGIOSA DEL JUDAÍSMO MUNDIAL LE VAN A CREER.

 

POR OTRO LADO HAY ALGUNOS JUDIOS QUE ASEGURAN QUE ESPERAN LA APARICIÓN DE UNA ESTRELLA EN LA CONSTELACIÓN DEL TORO, PORQUE ESTA SERÍA LA SEÑAL PARA ELLOS DE LA APARICIÓN DEL MESÍAS.

 

ASIMISMO LOS MULSUMANES ESTÁN ESPERANDO A SU MESÍAS.

 

Y CREO QUE ESA VA A SER LA COINCIDENCIA PARA AMBOS PUEBLOS RELIGIOSOS Y ENTONCES SIENDO EL MISMO MESÍAS PARA LOS DOS LOS VA A UNIR PROVISORIAMENTE, HACIENDO UN PACTO Y LUEGO A LA MITAD DE LA SEMANA 70 ROMPIÉNDOLO PARA QUE SE CUMPLAN LAS PROFECÍAS.

 

DESPUÉS TODO LO DEMAS QUE ESTAN HACIENDO ESTOS MUÑEQUITOS, TÍTERES DEL ANTICRISTO ES DISTRAERNOS, PREOCUPARNOS, ATEMORIZARNOS, INFLUENCIAR NUESTRAS MENTES, Y SEPARARNOS DE NUESTRO CREADOR

 

Y CREO POR ESO NOS HIZO HINCAPIÉ EN QUE VELEMOS Y OREMOS, PARA NO PERMITIR QUE LAS COSAS QUE PLANEAN Y HAGAN ESTOS TÍTERES NOS SAQUEN DE NUESTRO ESPÍRITU.

 

HABRÁ RUMORES DE GUERRAS Y GUERRAS, HAMBRES, PESTES Y TERREMOTOS, PERO NO OS PERTURBEIS, NOS DIJO JESUS, TODO ESTO TIENE QUE PASAR, PERO SOLO SERA  PRINCIPIOS DE DOLORES.

 

NOS AVISO SI DICEN QUE EL CRISTO ESTÁ POR AQUÍ O POR ALLÁ, QUE NO HAGAMOS CASO, PORQUE ES FALSO.

 

TE CONFIESO QUE CREO QUE EL TIEMPO DEL CUERPO DE CRISTO EN ESTE MUNDO, NO PASARÁ MÁS DE 30 DÍAS.

 

SI NO NOS VAMOS DEL 27 DE MAYO AL 6 DE JUNIO, NO VAN A QUEDAR MUCHOS DÍAS MÁS DESPUÉS DE ESA FECHA.

 

HOY ES SHABAT PARA LOS JUDIOS, ES DIA 20, EL 27 TAMBIÉN A PARTIR DE LAS 18 HORAS SERÁ EL SHABAT, EL SHABAT PARA NOSOTROS EL REPOSO, EL DESCANSO ES JESUCRISTO.

 

VENID A MÍ , TODOS LOS QUE ESTÁN TRABAJADOS Y CANSADOS.

 

HASTA AHORA SÓLO YO, DOY ESTA FECHA COMO POSIBLE, NADIE LA TOMA EN CUENTA.

 

Y LAS ESCRITURAS DICEN QUE VENDRÁ A LA HORA QUE MENOS PENSÁIS.

 

POR ÚLTIMO,

 

NO VEO CERCANA MI MUERTE, VEO CERCANO MI ARREBATAMIENTO.

 

AMEN

 

TKM

 

Yosef Arad

QUERIDO NOTARIO Y QUERIDOS HERMANOS DE ESE:

RUAJ HAKODESH HA PUESTO EN MI ESPIRITU/RUAJ EL ACLARAR DE UNA VEZ POR TODAS LA CUESTIÓN DE LAS FECHAS DEL NACIMIENTO Y MUERTE DE NUESTRO REDENTOR YESHUA HAMASHIAJ/JESUS EL MESÍAS, QUIEN FUE EL MISMO ELOHIM ENTREGADO A SI MISMO EN CARNE MORTAL Y RESUCITADO GLORIOSAMENTE EN CUERPO INCORRUPTO AL TERCER DIA SEGUN LAS ESCRITURAS, (LAS AUTENTICAS NO LAS MANIPULADAS TORTICERA E INTENCIONADAMENTE POR LAS FALSAS DOCTRINAS DURANTE 1700 AÑOS).

 

1.-NACIMIENTO DE YESHUA HAMASHIAJ/JESUS EL MESÍAS.

NO HACE FALTA SALIR DE LA BIBLIA PARA CONOCER EL DÍA EXACTO DEL NACIMIENTO DEL REDENTOR.

EN EL LIBRO DEL PROFETA DANIEL SE ESTABLECE UN PERIODO DE SETENTA SEMANAS (DE AÑOS) HASTA LA SEGUNDA VENIDA DEL MASHIAJ/MESIAS.

DE ELLAS PASARIAN 62 SEMANAS HASTA LA VENIDA DEL HIJO DEL HOMBRE LAS CUALES INICIARON CON EL DECRETO DEL REY PERSA ARTAJERHES PARA LA RECONSTRUCCIÓN DE JERUSALÉN,  DATO QUE ENCONTRANOS EN EL LIBRO DE NEHENIAS QUIEN ERA COPERO DE DICHO REY CUANDO EN EL AÑO 20 DE SU REINADO (455 AC) EMITIÓ DICHO DECRETO.

 

COMO SON 62 SEMANAS DE AÑOS (62×7=434 AÑOS)

DANIEL 9:25

«SABE, PUES QUE DESDE LA SALIDA DE LA ORDEN PARA RESTAURAR Y EDIFICAR A JERUSALÉN HASTA EL MESÍAS PRÍNCIPE HABRÁ SIETE SEMANAS Y 62 SEMANAS; SE VOLVERÁ A EDIFICAR LA PLAZA Y EL MURO EN TIEMPOS ANGUSTIOSOS»

 

POR LO TANTO SABIENDO QUE EL AÑO 20 DE ARTAJERJES COINCIDE CON EL 455 AC Y SUMANDOLE 434 AÑOS (62 ×7 SEMANAS) Y LOS SIETE PERIODOS DE AÑOS ADICIONALES (PORQUE EN EL CALENDARIO HEBREO SE CONTABAN LOS AÑOS POR PERIODOS DE 7 YA QUE EN EL 7@ ERA «SHEMITA» Y NO SE COSECHABA NADA Y SE LIBERABA A ESCLAVOS Y SE CANCELABAN DEUDAS).

 

ASI LOS 434 AÑOS EMPEZARON A CONTAR DESDE EL AÑO 450 AC (PORQUE ESE FUE EL AÑO «SHEMITA» MÁS CERCANO AL 455 AC AÑO DEL EDICTO DE ARTAJERJES).

ENTONCES TENEMOS QUE -450 +434= -16.

Y SUMANDOLE A ESTE LOS 9 «PAQUETES» DE AÑOS SHEMITA DE DICHO PERIODO TENEMOS QUE -16 +(-9)= -7.

ES DECIR EL AÑO -7 O 7 AC.

 

Y AQUI ES DONDE SE EQUIVOCÓ EL FRAILE «DIONISIO «EL EXIGUO» PORQUE EN EL AÑO 525 DC POR ENCARGO DE JUSTINIANO CALCULÓ MAL EL AÑO DEL NACIMIENTO DE YESHUA/JESUCRISTO YA QUE NO TUVO EN CUENTA QUE EL AÑO 0 NUNCA EXISTIÓ.

Y TAMPOCO TUVO EN CUENTA QUE EL NACIMIENTO SEGÚN PODEMOS ENCONTRAR EN EL EVANGELIO DE LUCAS COINCIDIO CON EL CENSO ANUAL QUE HACÍAN LOS ROMANOS COMO POTENCIA OCUPANTE DE JUDEA Y GALILEA.

 

PUES BIEN, DICHO CENSO SE HACIA SIEMPRE EN OTOÑO.

SI CALCULAMOS 6 MESES DESDE EL NACIMIENTO DE SU PRIMO JUAN EL BAUTISTA (SABEMOS QUE ESTE NACIÓ EN ABRIL PORQUE LA TRIBU A LA QUE PERTENECÍA SU PADRE ZACARÍAS TENIA ASIGNADO EL TURNO DE SERVICIO EN EL TEMPLO EN JULIO, QUE ES CUANDO SE LE APARECIÓ EL ANGEL Y LE DIJO QUE IBA A SER PADRE. NO TENEMOS MAS QUE SUMAR 9 MESES PARA SABER QUE JUAN NACIÓ EN ABRIL.

 

Y COMO EN EL MISMO EVANGELIO SE NOS DICE QUE MIRIAM CONCIBIÓ A YESHUA ESTANDO SU HERMANA EMBARAZADA DE 3 MESES NO HAY MÁS QUE SUMAR 6 MESES DESDE ABRIL Y TENEMOS QUE YESHUA HAMASHIAJ NACIÓ EN OCTUBRE DEL AÑO -5 (5 AC)

EL DÍA TUVO QUE SER NECESARIAMENTE EL 21 (SIETE ×3 O 777 ( DEL MES 7@ (TISHREI) QUE EN EL CALENDARIO JULIANO (VIGENTE EN EL I.ROMANO Y OCCIDENTE HASTA 1582) COINCIDIÓ EN EL 14 (7+7)  (DE OCTUBRE DEL AÑO -5 YA QUE HERODES ORDENÓ EL CENSO DE LOS NIÑOS DE HASTA 2 AÑOS Y MURIÓ EL AÑO -4 POR LO QUE ABARCARIÁ LOS NACIDOS ENTRE EL -6 Y EL. -4)

 

EN RESUMEN LA FECHA DEL NACIMIENTO DE NUESTRO ADON/SEÑOR FUE EL 14 DE OCTUBRE (21 DE TISHREU) DEL -5 O 5 AC

**********&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&_*********!*!!!!!!!!!!!**************

 

2-MUERTE

 

YA LO EXPUSE AQUI UN PAR DE VECES PERO NO PUEDO DEJAR DE DECIRLO UNA VEZ MAS PARA DEMOSTRAR BIBLIA EN MANO LA FALSEDAD M@SONIC@ DEL AÑO 33 Y. DE QUE ESA FUERA LA EDAD A LA QUE MURIÓ YESHUA/JESUCRISTO.

 

EL PUNTO DE PARTIDA ES EL MISMO: EL LIBRO DE NEHEMIAS QUIEN ERA COPERO DE ARTAJERJES Y EN EL AÑO 20@ DE SU REINADO (455 AC) EMITE EL EDICTO DE LA RECONSTRUCCIÓN DE JERUSALÉN.

 

SI SUMAMOS LAS 69 SEMANAS DE AÑOS DE DANIEL A ESTA CIFRA (69×7=483) NOS DA -455 + 483= 28.

VEINTIOCHO Y NO EL M@SONICO Y S@T@NICO 33 (LA PIRAMIDE M@SONIC@ DEL ONCE MULTIPLICADA POR SUS TRES LADOS O ÁNGULOS)

 

ES DECIR YESHUA/JESÚS MURIÓ (COMO NO PODÍA SER DE OTRA FORMA PARA SEGUIR CUMPLIENDO EL PATRÓN DEL NUNERO 7 O NUMERO DE EKOHIN) EL MIÉRCOLES 14 (7+7) DEL MES DE AVIV DEL AÑO 28 (7+7+7+7) DE NUESTRA ERA. VISPERA DE LA FIESTA DE PESAJ EXPIRANDO EXACTAMENTE A LA HORA DEL 3@ SACRIFICIO DEL CORDERO PASCUAL LAS 3 PM QUE EN EL CALENDARIO JULIANO ENTONCES VIGENTE CORRESPONDIÓ AL MIÉRCOLES 3 DE ABRIL (3+4=7) DE DICHO AÑO 28 DC.

 

Y LA RESURRECCIÓN TUVO LUGAR EN LA FIESTA HEBREA DEL «OMER RESHIT» EN ALGÚN MOMENTO DE LA NOCHE ENTRE EL VIERNES 16 Y EL SHABAT SEMANAL DEL 17 DE AVIV (ENTRE EL VIERNES 5 Y EL SABADO 6 DE ABRIL) ANTES DEL AMANECER PARA NO QUEBRANTAR EL ANGEL QUE REMOVIÓ LA PIEDRA DE LA SEPULTURA EL SAGRADO DIA DE REPOSO.

 

EN CONSECUENCIA YESHUA HAMASHIAJ/JESUCRISTO MURIÓ A LOS TREINTA Y UN AÑOS Y MEDIO (5 AC-28 DC) Y SU ÚLTIMO CUMPLEAÑOS FUE EL 14 DE OCTUBRE DEL AÑO 27 DC.

 

DEL AÑO -5 AL 27 HAY 32 YA LO SÉ PERO ES QUE NUNCA EXISTIÓ EL AÑO CERO SINO QUE SE PASO DEL AÑO -1 AL AÑO 1.

POR TANTO 32-1= 31.

Y NUNCA EL M@SONICO Y S@T@NICO 33.

 

ESTA ES LA VERDAD SEÑORES QUE EL @DVERS@RIO HA VENIDO OCULTANDO A LA HUMANIDAD CON TRETAS ARTIFICIOS Y MANIPULACIÓN DE LAS SAGRADAS ESCRITURAS DURANTE LOS ULTIMOS DOS MIL AÑOS.

 

TODA LA GLORIA /KOL HA KAVOD YEESHUA HAMASHIAJ QUIEN ES ELOHIM YHW TZEVAOT/YHWH DE LOS EJERCITOS.

HALLELUYA

Lkm

BENDICIONES

MARANATHA

4.181 palabras

 

RADIOESE.COM

 

EL ARREBATAMIENTO SERÁ ANTES DEL

20 DE MARZO DE 2023

 

Radio ESE emisión nº 127. 3ª parte.

 

Hoy es 21 de mayo de 2022

 

FALTAN 1.583 DÍAS PARA QUE JESUCRISTO ACABE CON TODOS LOS CERDOS DE LA TIERRA Y SU AGENDA 2030.

 

DESPUÉS DEL ARREBATAMIENTO:

 

Cuando nos vayamos se abrirán los sellos del Apocalipsis, Dios invita a la humanidad que no creyó en el arrebatamiento al banquete de la ira de Dios.

 

Como dice Jajam la misericordia de Dios hace que primero vengan los sellos, luego las trompetas y al final las copas. Dios es misericordioso y también justo. Da tiempo a la humanidad para que se vuelva a Él. Podría acabar con la humanidad ahora y les da un tiempo. Tres años y medio.

 

De aperitivo los 7 sellos del Apocalipsis.

 

El primer sello.  Aparecerá y se dará a conocer El anticristo. Eso sucederá antes del 21 de marzo de 2023.

 

El segundo sello. La guerra nuclear que se producirá más o menos por esas fechas.

 

El tercer sello. La carestía y la estanflación (estancamiento económico + inflación)

 

El cuarto sello. La peste, la hambruna y las llagas.

 

El quinto sello. El avivamiento.

 

El sexto sello. Un gran terremoto como no lo hubo jamás en la tierra.

 

Y el Séptimo sello un silencio en la tierra y en el cielo mientras los ángeles de Dios preparan las siete trompetas de la ira de Dios.

 

De primer plato vendrán las 7 trompetas de la ira de Dios.

 

Y de segundo plato las 7 copas de la ira de Dios.

 

El postre será la parusía. Jesucristo pondrá sus pies en el monte de los Olivos en Jerusalén, según los cálculos de esta notaría del Señor Jesucristo en la tierra será el 21 de septiembre de 2026, ratificado por sor Paquita en un milagro en vivo y en directo aquí en ESE. Y con el visto bueno de Ledeshmá Menájem, de Jajam y de José el notario.

 

Entonces todos los cerdos y todos los que han estado a su servicio, y todos los reptiles galácticos 6-M y todo aquel que renunció al amor de Dios serán juzgados y condenados al lago de fuego por los siglos de los siglos.

 

Todos los que eligieron a Barrabás serán castigados en el fuego eterno. Solo podrán ser salvos los que opten por el martirio y renuncien a adorar al anticristo que es Satanás.

 

Trump pondrá fin a la guerra, pero será después de la guerra termonuclear. Pronto China atacará a Taiwán e  Israel atacará a Irán, el caos será total. Por eso nos vamos, para que no nos alcance.

 

Aquí se quedarán los incrédulos y los cybermonos con su nueva normalidad y su  bozal obligatorio, esperando la vacuna ARNm y el identificador digital ID2020 que le dirá a los cerdos y a su policía política satánica (policía del pensamiento) quien está vacunado y quien no lo está, y NO les  liberará del bozal y les  convertirá en zombis mutantes rompiendo el cordón umbilical que les  ligaba a Dios.

 

Los kakunados ya no son de Dios ya son propiedad de Satanás y además están patentados. La mayoría emiten señales de bluetooth, están marcados con un código de 12 dígitos, como si fueran cosas. Son cerdos mutantes.

 

 

¿Sabéis por qué quieren que el 100% esté kakunado? Porque si hay una parte de la población sin kakunar habría un grupo de control distinto del de kakunados que demostrará que los no kakunados no se contagian ni mueren, mientras que los kakunados morirán en su gran mayoría en uno o dos años. Morirán como chinches a partir del momento que las antenas 5 JE emitan a 26 gigahercios. Y sobre todo porque los kakunados tienen alterado su ADN y no pueden ser arrebatados, salvo que Dios milagrosamente les borre el contenido satánico de su ADN.

 

Recordad que en TV no nos cuentan que los fabricantes de las vacunas han pedido y han conseguido no ser responsables ni civiles ni penales ante cualquier efecto secundario perverso de la vacuna. Además han conseguido mantener en secreto el contenido de las kakunas. Llevan nano-demonios vivos dentro, (morgellons). Seres vivos maléficos que se dirigen a sus neuronas y los convertirán en demonios sin que se enteren. Lo último es que los científicos que se atreven a investigar dicen que llevan ADN extraterrestre.

 

Vanguard Group y Blak Rock son los dos grupos de inversión que poseen el 90% de todas las empresas y bienes de esta tierra. Todos son lagartos, todos son hijos de la serpiente antigua, son  cerdos 6-M. Masones, miserables, mezquinos, malvados, mal nacidos y mamones porque son todos usureros.

 

Controlan el Vaticano, a todos los políticos, todas las radios y todas las televisiones del mundo y la prensa, las fábricas de alimentos, de piensos, de armamento, de ropa, Google, Facebook, las empresas de tecnología, YouTube, toda la red de Internet, y todo lo que se te ocurra. Todos le sirven porque sirven a Satán.

 

Controlan a todos los políticos del mundo, por eso le hacen la guerra. Putin no sigue la agenda 2030, ni matrimonio homosexual, ni niños, niñas, niñes y travestis, ni igualdad de género ni demás mamarrachadas que solo muestran la decadencia y el baboso hundimiento de los valores morales de occidente. Ni primer progenitor ni segundo progenitor, solo papá y mamá. Eso les jode mucho a los globalistas.

 

Y ahora viene la hambruna y la tontería del cambio climático y el CO2 a cero. Y Vil Puertas del infierno obligando al mundo a comer carne sintética, (que fabrica él)  que se compone de insectos, gusanos y mierda reciclada. Humilla a los cerdos mutantes, porque ya no son humanos. Ha comprado miles de hectáreas de tierra en USA y Sudamérica para dejarlos sin cultivar y llevar la hambruna a los cerdos que una vez fueron humanos.

 

Recordad ver el vídeo Covid 1984 la novela del siglo y veréis que las democracias aliadas vencedoras de la II Guerra Mundial son las que van a establecer la gran dictadura mundial de Satanás, con el Papa Francisco a la cabeza, y el visto bueno de todas las logias masónicas del mundo. Y con Enmanuel Macron como el anticristo político o el Trampas. Y la agenda 2030.

 

Lo que viene es el Gran Hermano, es el N.O.M., peor que en  la novela 1984. Se están desatando ante vuestros ojos los sellos del Apocalipsis y muy pocos lo ven.

 

Además en las vacunas ARNm utilizan tecnología CRISPR y proteína CAS9, pero también tatuajes cuánticos o micro partículas cuánticas inyectadas en las vacunas.

 

Y ya lo último es que ahora viene la guerra termonuclear, luego la activación de las antenas 5JE en 26 Mega hertzios, y la cesión de la soberanía nacional de todas las democracias a favor de la O.M.S. (Organización Mundial de Satanás), controlada por el reptil galáctico Klaus Schwab y el demonio encarnado Kill Puertas.

Las democracias nos llevan siempre a la dictadura satánica. Apocalipsis 17-17.

 

Esta mañana me ha venido a la cabeza una idea. Jesús tenía 12 apóstoles, no eran 20 ni tampoco 24, eran 12.

Estaba conduciendo el coche y me he preguntado. ¿Cuántos hermanos de ESE hacen comentarios casi cada día?

 

Al llegar a casa he abierto el correo y he mirado las carpetas. Hay algún hermano que colabora en ESE esporádicamente, como Fernando, Leony Gees, Álvaro, David, Ibacache, Solange, Luis de N.Y. Edu Wojna  y otros, pero fijaros en esto, hay 12 que comentan siempre. Alguno como Ernesto ya murió y vino otro a sustituirle.

 

Jesús tenía 12 apóstoles, en ESE (la web de Jesús, Su notaría en la tierra) tenemos 12 comentaristas.

 

Alejandro

Yosef Arad

EGE

Abel Real

Zack

Mª Jesús

Patagonia

Danna

Susana

José de ESE

Ledeshmá Menájem

Ángel Serafín (Franz Systems)

 

No me digáis hermanos de ESE que no es curioso. Además están repartidos por el mundo.

España, México, Argentina, Chile, Uruguay, Colombia  y Canadá.

 

No somos muchos, pero somos los que tenemos que ser.

 

 

Alejandro.

SI MORIMOS, EN CRISTO MORIMOS, Y SI VIVIMOS, EN CRISTO VIVIMOS

SEA UNA U OTRA, SIEMPRE GANAMOS, PORQUE EN CRISTO ESTAMOS.

 

NOSOTROS ESTAMOS VACUNADOS CON LA CRISTOMICINA

 

Y LA CRISTOMICINA NOS DA LA VIDA ETERNA, Y LA MUERTE NO TIENE PODER SOBRE NOSOTROS.

 

COMO DIJO JESÚS  EN  JUAN 11:25

 

Le dice Jesús: YO SOY la resurrección y la vida; el que cree en mí, aunque esté muerto, vivirá.

 

 

CONCLUSION PARA PREPARAR A LA NOVIA PARA LA BODA CON EL CORDERO SE NECESITA.

 

1 TENER EL ACEITE (EL ESPIRITU SANTO)

 

2 ESTAR LLENOS DEL ESPIRITU SANTO PARA QUE NO SE APAGUE NUESTRA LÁMPARA

 

3 CRISTO EN CUALQUIER MOMENTO NOS LLAMA

 

Estos son los comentarios que he seleccionado estos días:

 

Zack Saetonious

EVENTUALMENTE LA ESCASEZ MUNDIAL ARTIFICIAL DE ALIMENTOS DARA PIE A LA MIGRACION DE LA GENTE SACANDOLOS DE SUS HOGARES Y CON ELLO LA EXPOSICION A LOS MUCHOS PELIGROS Y RIESGOS EXISTENTES HACIA DONDE PUEDAN HALLAR DONDE ALIMENTO Y CONDICIONES MINIMAS DE VIDA……..LAS MIGRACIONES MUNDIALES SE ACENTUARAN

LOS GOBIERNOS DONDE GOLPEE MAS LA CRISIS Y NO PUEDAN COMBATIRLA ESTAN CONDENADOS AL DERROCAMIENTO, LA PURGA, LA GUERRA CIVIL… Y AL EXTERMINIO …. CRISIS MUNDIAL

LA INDIA YA PROHIBIO LA EXPORTACION DE TRIGO … EN UN INTENTO DE FRENAR LA SUBIDA BRUTAL DEL PRECIO DEL CEREAL.

EL PAN YA SUBIO EN IRAN Y HAY SAQUEOS Y PROTESTAS POR LA ANULACION DE SUBSIDIOS A LOS ALIMENTOS DE PRIMERA NECESIDAD.

EN AMERICA DEL SUR EL PROMEDIO DE UNIDADES DE PAN POR DOLAR ESTADOUNIDENSE SON: 13 UNIDADES…. ANTES DE LA CRISIS ERA 20 PANES.

———————————————————————————————————————

LO MEJOR QUE PUEDEN HACER AHORA ES OPTAR POR CULTIVAR TRIGO GERMINADO…. LO PUEDE HACER HASTA EN UNA BATEA EN DESHUSO EN SU TEJADO O EN SU JARDIN.

EL TRIGO INICIA GERMINACION A LOS 02 DIAS DE REHOGARLO EN AGUA … ES DESPUES DE ESE TIEMPO QUE COMIENZA A HECHAR RAICILLAS, SI TIENE UN GERMINADOR DE SEMILLAS EL PROCESO ES MAS FACIL… A LOS 04 DIAS LAS RAICILLAS HAN CRECIDO LO SUFICIENTE … YA SE PUEDE TRASPLANTAR A TIERRA… SI LO HACE DESPUES LA COMPACTACION DE LAS RAICILLAS CREARA UNA ESPECIE DE ALFOMBRA ENTRECRUZADA Y SERA MAS DIFICIL TRASLADAR A TIERRA ….

HAY MUCHOS VIDEOS DE COMO CULTIVAR TRIGO EN BATEAS, JARDIN O HUERTO.

OS DEJO ESTE ENLACE:

https://www.tusbrotesverdes.com/blog/germinar-hierba-de-trigo/

 

Zack Saetonious

 

TRIGO, CEBADA, ACEITE …. VINO

TRIGO, CEBADA, ACEITE …. VINO

TRIGO, CEBADA, ACEITE …. VINO

 

Al-Wali

Trigo: Gran Multitud.

Cebada: 144.000

Aceite: Mesías.

Vino: Fiesta, Justicia, Felicidad, Consuelo, Sanidad, Abundancia.

https://www.lacasadeisrael.org/estudios-biblicos/los-alimentos-en-la-biblia-y-su-significado-espiritual/el-vino-en-la-biblia-y-su-significado-espiritual/

 

Maria Jesus

SÍ, YOSEF, PERO SEGÚN SE EXPLICA, QUISIERON BAJAR A LA TIERRA PARA AYUDAR A OTROS, ¿PERO A QUIÉN? ES UN POCO FABULA ESTE RELATO,

LO CIERTO ES QUE DESOBEDECIERON, Y TODA SU DESCENDENCIA, SUFRIMOS LAS CONSECUENCIAS,

BENDICIONES ESTIMADO, TKM, MARANATHA 🙏💙

 

JAJAJA, PERO SI NO SE TE ESCAPA UNA!!!

¿COMO VAS A TENER PROBLEMAS INTELECTIVOS? JAJA

BENDICIONES ESTIMADO YOSEF, MARANATHA 🙏💙

 

Maria Jesus

HE MIRADO EL LISTADO DE APELLIDOS SEFARDÍES, Y LOPEZ TAMBIÉN SIGNIFICA LOBO.

Y SI VAS A BUSCAR MEDIA ESPAÑA ES DE ORIGEN HEBREO, Y DE LA OTRA MEDIA, HAY UN PORCENTAJE DE ORIGEN ÁRABE, PORQUE NO TODOS SE FUERON, ALGUNOS FINGIERON HACERSE CRISTIANOS.

AHORA SE ENTIENDE LA FRASE «EUROPA EMPIEZA EN LOS PIRINEOS»

BENDICIONES ESTIMADO, MARANATHA 🙏💙

 

Maria Jesus

ESTIMADO ALEJANDRO, SÍ, TIENES RAZÓN, YO HICE AYUNO EL 16 POR SI ACASO,

PERO BUENO NO ESTÁ DEMÁS AYUNAR UN DÍA,

BENDICIONES ESTIMADO, TKM, MARANATHA, 🙏💙

 

Zack Saetonious

 

Militares ucranianos y neonazis de Azov saliendo de la planta de Azovstal en Mariupol

https://rutube.ru/video/8754e750747df1596843ee4075d12dcb/

 

Zack Saetonious

ES MENTIRA QUE LA SUBIDA DE LOS FERTILIZANTES A NIVEL MUNDIAL SE DEBA A LA GUERRA CON RUSIA … DESDE ANTES QUE INICIARA EL CONFLICTO LOS PRECIOS DEL NITROGENO, FOSFORO, POTASIO (NPK)  YA ESTABAN TREPANDO LA CUESTA COMO INDICA LA GRAFICA ADJUNTA…..LA GUERRA SOLO LE DIO UN EMPUJONCITO…. SINO SE HUBIERA DADO LA GUERRA IGUAL LA SUBIDA ERA INEVITABLE …. EL DISPARADOR FUE LA PLANDEMIA……

————————————————————————————————————————————————————

Mayo 6, 2022 – Economia & Negocios

El aumento de los precios de los fertilizantes pone en peligro la seguridad alimentaria mundial

Emily Peck, autor de Mercados Axios

https://imgur.com/a/mrsv4af

Las crisis continuas de los últimos años hicieron visibles tantos productos básicos vitales que muchos de nosotros nunca pensamos mucho: níquel, chips de silicio, madera . El último participante en este campamento: Fertilizer.

Por qué es importante: El aumento vertiginoso de los costos de los fertilizantes, como los que se fabrican con nitrógeno, fósforo y potasio (NPK), está elevando los precios de los alimentos y, lo que es peor, amenaza la seguridad alimentaria en todo el mundo.

Situación actual : los precios del NPK aumentaron un 125 % en enero con respecto al año anterior y aumentaron otro 17 % desde principios de año hasta marzo, según datos recopilados por el Instituto Internacional de Investigación sobre Políticas Alimentarias (IFPRI).

La inminente prohibición europea sobre el gas natural ruso (un componente crítico en la fabricación de algunos fertilizantes) podría empeorar la situación.

«Estamos en una situación desesperada en este momento», dijo Svein Tore Holsether, director ejecutivo del fabricante de fertilizantes Yara International, en un seminario organizado por IFPRI esta semana.

Si los agricultores usan menos fertilizantes, no pueden producir tantos cultivos, y eso plantea el espectro de «desnutrición, inestabilidad política y, en última instancia, la pérdida evitable de vidas humanas», informó Bloomberg .

El panorama general: los precios de estas materias primas fuertemente comercializadas ya estaban aumentando en 2021, debido a una gran cantidad de factores: el huracán Ida en los EEUU. un aumento de la demanda después de la pandemia, los problemas de la cadena de suministro y el aumento de los precios del gas natural que precedieron a la guerra en Ucrania.guerra en Ucrania.

Luego, dos cosas lo empeoraron:

China: El país, que suministra el 24% de los fosfatos del mundo, el 13% del nitrógeno y el 2% de la potasa, detuvo las exportaciones de fertilizantes el verano pasado.

Guerra: La invasión rusa de Ucrania interrumpió el comercio en el Mar Negro, poniendo en peligro el suministro mundial de alimentos en general (por ejemplo, la interrupción del trigo ). Rusia y su aliado Bielorrusia también producen mucho fertilizante. En 2020, Rusia proporcionó el 14 % de urea (un fertilizante nitrogenado) y, con Bielorrusia, el 41 % de potasa, un fertilizante de potasio.

Importante: el fertilizante es un producto muy comercializado, lo que significa que la mayoría de los países ,  incluso los que producen muchos alimentos, importan su suministro.

Tres cuartas partes de los países del mundo dependen de fertilizantes importados para el 50% o más de su uso de fertilizantes, señala IFPR.

Algunos países, incluidos Mongolia, Nicaragua y Ecuador, están a merced de las políticas rusas y chinas con la mayoría de sus suministros de fertilizante cortados.

El resultado final: en los países más ricos, seguiremos viendo precios más altos de los alimentos, y en los países más vulnerables las cosas podrían volverse desesperadas.

“Muchos campos no se están sembrando” , dijo ayer Theo de Jager , presidente de la Organización Mundial de Agricultores . «No estoy tan seguro de que sea posible evitar una crisis alimentaria».

«Los agricultores necesitan paz», dijo de Jager.

https://www.axios.com/2022/05/06/fertilizer-prices-food-securtiy

 

Zack Saetonious 0.

APOCALIPSIS 6:5-6 BIBLIA DEL OSO 1569

5 Y quando el vuo abierto el TERCERO SELLO, oy àl TERCER animal que dezia: Ven, y mira. Y miré, y heaqui vn cauallo negro, y el que eſtaua ſentado encima del, tenia vn peſo en ſu mano.

6 Y oy vna boz en medio de los quatro animales, que dezia: Vn cheniz de TRIGO por vn denario: y tres chenizes de CEBADA por vn denario: y no hagas daño àl VINO, ni àl ACEITE.

 

Yosef Arad

PERMITE OPERAR A MEDIOS EXTRANJEROS Y NO HACE MÁS QUE DAR CIFRAS FALSAS Y MANIPULADAS.

EN PRIMER LUGAR NO HAY «INFECTADOS» SINO INTOXICADOS Y/O IRRADIADOS PORQUE NO EXISTE NINGÚN V1RU$ SINO LOS EFECTOS DE LA INTERACCION DEL GR4F3N0 INOCUL@DO Y LAS ONDAS ELECTROMAGNÉTICAS DE LAS @NT3N@S.

 

ADEMÁS SIGUEN FIRMANDO LOS DATOS Y ESTADÍSTICAS FALSAS PARA QUE NO HAYA DUDA DE SU AUTORÍA Y MANIPULACIÓN:

56 (5+6=11) MUERTOS

PERSONAS CON FIEBRE: 1.483.O00 O SEA UN LUSTROSO 11=8+3 DESPUES DEL 14 (ESTE PARA DISIMULAR)

PODRIA SEGUIR PERO ES TAN OBVIO QUE SÓLO UN CIEGO O UN ADOCTRINADO NO LO VEN (O NO QUIEREN VERLO QUE ES PEOR)

LKM

BENDICIONES

 

Zack Saetonious

 

LA RATIFICACION DE EN QUE TIEMPO APOCALIPTICO ESTAMOS….Y LO QUE SIGUE AL PARECER ES OTRA RATIFICACION….LA GRAN TRIBULACION….PERO LO DICE CON OTRAS PALABRAS.

APOCALIPSIS 6-7-8 BIBLIA DEL OSO 1569

7 Y deſque el abrio el quarto ſello, oy la boz del quarto animal, que dezia: Ven, y vee.

8 Y miré, y heaqui vn cauallo amarillo: y elque eſtaua ſentado ſobre el, tenia por nõbre, Muerte: y el ynfierno le ſeguîa: y fuele dada poteſtad ſobre la quarta parte de la tierra, para matar con cuchillo, con hãbre, con mortandad, y cõ beſtias de la tierra.

 

Yosef Arad

OTRA VEZ «DANDO LA MATRACA» CON UN «NUEVO V1RU$» ESTA VEZ PROCEDENTE DE UN

MONO ( QUE POCO ORIGINALES SON PIRQUE REPITEN EL ESCENARIO DE L AVCIDENTE DE UN CAMION CON MONOS EN PENSILVANIA (EEUU))

0TRA VEZ 4 MONOS (POR LO QUE OS DIJE DEL PASO DE LA 4@ A LA 3@ (LA NUESTRA) DIMENSIÓN S E LAS ENTIDADES R3PTILI@N@S. DEMONI@C@S A LAS QUEVINVOCAN).

EN CUANTO A LA H3P@TITUS(NOEMBRE MÉDICO PARA LA INFLAMACIÓN DEl HIGADO) ES OTRO DE LOS EFECTOS PATOLÓGICOS DE LA INTOXICACIÓN POR OXIDO DE GR4F3N0 .

EL YTUBER DE NUEVO «NI FLOWERS»

LKM

BENDICIONES

MARANATHAL

https://youtu.be/kP_dFyg-PLI

 

 

Yosef Arad

LOS MENTIROSOS (EN ESTE CASO CNN EN ESPALOL) ECHAN LA CULPA A LA «CONT@MINAC1ON»(Y NO AL GR4F3N0 CLARO)

https://cnnespanol.cnn.com/2022/05/18/personas-muere-contaminacion-mundo-estudio-india-trax/

LKM

BENDICIONES

 

Yosef Arad

EL CEMENTERIO SE LLENÓ DE SEÑALES BLUETOOTH MIENTRAS LOS MUERTOS EMITÍAN DIRECCIONES «MAC» DESDE SUS TUMBAS.

https://beforeitsnews.com/alternative/2022/05/cemetery-filled-with-bluetooth-signals-as-dead-vaccinated-emit-mac-addresses-from-the-grave-3773030.html

LKM

BENDICIONES

MARANATHA

 

Yosef Arad

PERIODISTA NORTEAMERICANO:

HE LEIDO EL «KUBRI» DE VIL PUERTAS PARA QUE TU NO TENGAS QUE HACERLO.

EXASPERANTE,RIDÍCULO,NAUSEABUNDO Y RISIBLE

.https://www.eldiestro.es/2022/05/periodista-estadounidense-he-leido-el-libro-de-bill-gates-para-que-tu-no-tengas-que-hacerlo-y-es-tan-exasperante-nauseabundo-ridiculo-y-risible-como-cabria-esperar/

Lkm

BENDICIONES

MARANATHA

 

Yosef Arad

LOS APÓSTOLES JAMÁS REPOSARON EN DOMINGO

https://youtu.be/88AqUnwxEPY

LKM

 

Zack Saetonious

REUTERS NO OPERA EN NOR COREA, SEGURO Y SE COLGO DE ALGUN MEDIO RECONOCIDO POR EL REGIMEN DE KIM JONG UN Y MANIPULO LAS CIFRAS …. SEGUN LEI HAY POCOS MEDIOS INFORMATIVOS COMO LA AGENCIA FRANCE PRESS, KYODO NEWS (JAPONESA) ENTRE OTRAS QUE OPERAN EN EL PAIS …. NINGUNA DE EEUU.

SOBRE LO DEMAS …. NOR COREA NO HABIA REALIZADO ANTES DE LA EXPLOSION DE CONTAGIOS CAMPAÑAS DE VACUNACION ALGUNA PORQUE SE CONFIO EN LA HERMETICIDAD DE SU POLITICA DE PUERTAS CERRADAS POR EL SUR Y NORTE Y ALGUNA QUE OTRA MEDIDA PROPIA (SIMILAR A LA CHINA POSIBLEMENTE….DESAPARICION DE INFECTADOS PARA CONTENER LOS BROTES) DEL REGIMEN COMUNISTA QUE VIVE EL PAIS. ASI QUE NO HUBO COMPLICACIONES DEL GRAFENO PORQUE NO HABIA VACUNADOS ….

NOR COREA ES EL PATITO FEO EN CUANTO A COMUNICACIONES ….SOLO CUENTA CON 3G (LO MANEJA ESTRICTAMENTE EL GOBIERNO Y SU INFRAESTRUCTURA NACIONAL DE TELECOMUNICACIONES ES ESCASA……NO HAY SUSTENTO PARA SUPONER QUE HUBO UNA SOBREEXPOSICION A LA RADIACION DE ANTENAS DE TELECOMUNICACION….

LO SOSPECHOSO ES QUE ACERCANDOSE LA VISITA DE BIDEN EN PROXIMOS DIAS A SEUL (SUR KOREA) Y ANTE EL SUPUESTO Y PROXIMO ENSAYO NUCLEAR DE KIN JONG UN OCURRA ESE CONTAGIO …DIGAMOS MASIVO….. POSIBLEMENTE FACTORES EXTERNOS PUDIERON HACER ESTALLAR EL MISMO….LAS OPCIONES DE COMO PUDIERON INTRODUCIRLO SON MUCHAS…. Y LAS POTENCIAS QUE NO QUIEREN UNA NOR COREA FUERTE SABEN COMO HACERLO.

SOBRE LO DEMAS NO VOY A ENTRAR EN DISCUSION..

 

Yosef Arad

UCRANIA «GANÓ» «TONGOVISIOB»

https://youtu.be/OoXvG__139Y

LKM

BENDICIONES

 

Zack Saetonious

DANDO SUSTENTO CIENTIFICO AL PLANETA X … ESTOS CREEN QUE YA LLEGO EL 04 DE JULIO….. SI EXISTE EL PLANETA X …..POSIBLEMENTE EXISTA SU NEMESIS.

———————————————————————————————————————————————————-

Universo misterioso: un quinto planeta gigante arruinó las órbitas de Júpiter, Saturno, Urano y Neptuno

18 de mayo de 20221

Los astrónomos corroboran la conspiración del Planeta X

Los astrónomos corroboran la teoría de la conspiración del Planeta X. Imagen: NASA / JPL-Caltech

Las órbitas planetarias actuales del sistema solar parecen estables, pero eso es solo porque los planetas se han asentado en ellas durante miles de millones de años. El sistema solar primitivo era un lugar muy diferente al que se ve hoy, y durante casi 20 años, los científicos pensaron que tenían una buena idea de cómo llegó a ser así.

Pero más recientemente, los datos habían comenzado a señalar algunas fallas en esa comprensión, especialmente sobre cómo los planetas gigantes en el sistema solar exterior llegaron a donde están hoy.

Proteja su hogar y automóvil contra EMP, erupciones solares y ataques de rayos con el mejor escudo disponible en la actualidad (reducción adicional de $ 50 con cupón: ‘strangesounds’) …

Ahora, un equipo internacional de astrofísicos cree que tiene una mejor comprensión de ese proceso y cree que podría ayudar a resolver un argumento de larga data sobre el sistema solar primitivo.

https://imgur.com/a/XdSRyR4

Actualmente, el mejor modelo que tienen los científicos para la formación del sistema solar se conoce como el modelo de Niza, en honor a la ciudad de Francia, donde se desarrolló por primera vez en 2005.

Como parte de este modelo, los gigantes gaseosos que actualmente residen en los límites exteriores de este sistema solar originalmente orbitaron lo que se convirtió en el sol mucho más cerca con órbitas más circulares.

Sin embargo, algo causó inestabilidad en el sistema que expulsó a esos planetas a las órbitas oblongas y espaciadas mucho más desiguales en las que los vemos hoy.

Qué causó exactamente esa anomalía hasta ahora ha sido un misterio. Sin embargo, un equipo compuesto por investigadores de la Universidad Estatal de Michigan, la Universidad de Zhejiang y la Universidad de Burdeos cree tener una respuesta. Es tan simple como el polvo en el viento (solar).

En el sistema solar primitivo, los gigantes gaseosos se asentaron en una nube de polvo alrededor del sol naciente en órbitas casi circulares. Cuando el sol se encendió, comenzó a soplar el polvo del disco circunestelar. Algo de ese polvo pasó por la órbita o los gigantes gaseosos, causando la inestabilidad que ve el modelo de Niza.

Sin embargo, la forma en que los investigadores desarrollaron la idea también resuelve algunos problemas que tenía el modelo de Niza. Uno de los principales fueron los datos, como los recopilados de las muestras de la luna, que apuntaban a un camino mucho más rápido hacia esta inestabilidad que se encontraba típicamente en el modelo original de Niza.

Con este modelo actualizado de evaporación de nubes de polvo «de adentro hacia afuera», el laborioso camino de inestabilidad de cientos de millones de años se condensa en una línea de tiempo de unos pocos millones de años, que coincide mucho mejor con los datos existentes.

Modelo del Planeta X en Niza

Sin embargo, esos no son los únicos datos con los que coincide bien. El modelo de Niza en sí mismo es parcialmente controvertido por señalar un noveno planeta potencial en el sistema solar primitivo, y no significa Plutón.

https://www.youtube.com/watch?v=zY4X2RBxptE

Uno de los favoritos de muchos observadores del cielo conspiradores, el Planeta 9 (o Planeta X) ha estado atrayendo cada vez más la atención después de que un estudio de Caltech en 2015 descubriera que podría haber algo enorme al acecho a unas 50 mil millones de millas del Sol.

El modelo original de Niza en realidad funciona mejor con cinco planetas interiores gigantes gaseosos, pero en esos cálculos, uno de esos planetas es expulsado al espacio interestelar para convertirse en un planeta rebelde.

En el modelo actualizado, el resultado de la alineación orbital planetaria es esencialmente el mismo ya sea que haya cuatro o cinco gigantes gaseosos iniciales en el sistema. Sin embargo, se ajustan un poco mejor a la realidad si solo hay cuatro planetas inicialmente introducidos en el modelo.

Al igual que con muchas teorías, este nuevo modelo podría afectar potencialmente nuestra comprensión de la formación del sistema solar primitivo y podría resolver un argumento de larga data sobre cuál fue el desencadenante original de la inestabilidad que dio forma a nuestros vecinos planetarios.

Pero, en última instancia, incluso este nuevo modelo tendrá que soportar los datos, y eso es mucho más para recopilar antes de que se aclare la verdadera historia de nuestro sistema solar primitivo.

https://www.universetoday.com/155923/did-a-5th-giant-planet-mess-up-the-orbits-of-jupiter-saturn-uranus-and-neptune/

 

Yosef Arad

«LA CUKPA» DE LA «EXTRALA ENFERMEDAD» DE LOS NIÑOS (EN REALIDAD UNA HEPATITIS CAUSADA PIR EL ÓXIDO DE GR4F3N0) AHORA ES DE LOS PIBRES PERROS.

ESTOS HIJOS DE s…s» AHORA TAMBIÉN VAN A POR LOS MÁS NOBLES T FIELES COMPAÑEROS S EL SER HUMANO.

YHWH LOS REPRENDA

https://youtu.be/cryketqp5oE

Lkm

BENDICIONES

 

Yosef Arad

TESTIMONIO DE ANDREU BLANES ATKETA DESPUÉS DE KA 3@ K@KUN@.

https://odysee.com/@AlfAnonymous:3/Adreu-Blanes-1:c

LKM

BENDICIONES

 

Yosef Arad

EURODIPUTADO CROATA DICE TODA KA VERDAD SOBRECEL COV1D SIN PELOSCEN KA KENGUA.

¿DISIDENCIA CONTROLADA?

LO DEJO A VUESTRO CRITERIO

https://odysee.com/@AlfAnonymous:3/DIPUTADO-EUROPEO-ALERTA-DEL-FUTURO:c

LKM

BENDICIONES

 

Yosef Arad

PUES TABTA «UNANIMIDAD OFICIALISTA» SOBRE LA «CONSPURANOUA» DE LA TEIRIA DEL PKANETA(EN REALIDAD ES UN PLANETA-COMETA) ME HACEN PENSAR QYE ES VERDAD

SI NO NO SE HAVRIAN ESFIRZADI TABTO EN DESMENTIRLO

YO CREO QUE TENÍA RAZON EL ASTRONOMO CHILENO MUÑOZ FERRADAS Y HOY EN DIA EL NORTEAMERICANO GILL BROUSSARD.

OS RECOMIENDO LO VISIINEIS

AQUI PAGINA EN YT

https://youtube.com/c/Planet7X

 

Yosef Arad

LA COMUNIDAD DE MADRID (DE LA CORRUPT@ IS@VAL DIAZ ABUSO) PROPALANDO EL BULO DEL NUEVO «V1RU$»MONKEYPOX»

PRONTO ABRIRÁN LAS @NTEN@S A 26 GHZ Y LA CULPA LA TENDRAN LOS MONOS

Y POR SUPUESTO EL «ASCO» DEL GRYPI EDITIR1@L «PRISA» DIFUNDIENDOLO.

MADRIDISTAN

https://as.com/diarioas/2022/05/18/actualidad/1652856652_763114.html

LKM

BENDICIONES

 

EGE

Amigos… muchos comentarios… bueno sí como decís efectivamente ahora viene el «virus» del mono… jaj

.

Primero dio la voz de alarma Reino Unido, luego Portugal y ahora España. El Ministerio de Sanidad ha enviado una alerta a todas las Comunidades Autónomas tras la detección en la Comunidad de Madrid, este martes 17 de mayo, de ocho casos sospechosos de pacientes que presenten una infección compatible con el virus de la viruela del mono.

.

https://gacetinmadrid.com/2022/05/18/crecen-a-23-los-posibles-casos-de-viruela-del-mono-en-madrid/

.

Y es que son tantas las películas que tratan del mismo argumento…como por ejemplo Estallido de 1995.. que poco originales son a la hora de asustar al rebaño…

.

Pues nada… Sí, como dices Alejandro… HACKEEMOS este sistema… como en «matrix»…. a ver si podemos escapar y llegar a la nave esa del mundo real…  bueno igual eso es precísamente el arrebatamiento.. veremos todo desde la NAVE… de Dios mientras este mundo le caen todos los juicios…

.

Entonces que tenemos que esperar… lo mismo que en 2020?… pero ahora con el PLUS de la guerra, la hambruna, etc…. Yo por mi … me parece bien que conviertan este circo dantesco de mundo ya en su tribulación… para que nuestro buen Dios se apiade de nosotros y nos saque de aquí ya muy muy pronto….

.

https://bylinetimes-com.translate.goog/2022/05/17/global-banks-privately-prepare-for-dangerous-levels-of-imminent-civil-unrest-in-western-homelands/?_x_tr_sl=auto&_x_tr_tl=es&_x_tr_hl=es&_x_tr_pto=wapp

 

EGE

El 22 de mayo: la OMS tendrá autoridad para bloquear todo Estados Unidos

https://www-israel365news-com.translate.goog/269274/on-may-22-biden-to-hand-over-american-sovereignty-to-who/?_x_tr_sl=auto&_x_tr_tl=es&_x_tr_hl=es&_x_tr_pto=wapp

.

En este nuevo circo… le pasan todo poder y autoridad a «la bestia» a la OMS… para confinar países… kakunar a la fuerza y acabar ya de machacar los pocos derechos fundamentales que quedan…. solo decir que CUANTO PEOR… MEJOR…. nuestra redención a las puertas..

 

Al-Wali

Al final José tenía razón, porque la viruela del mono no afectaba al hombre, pero como a muchos los convirtieron en “cigimonos”…

 

Zack Saetonious

CAIGO EN LA CUENTA QUE UCRANIA, RUSIA, LA OTAN Y EEUU CON SUS ACCIONES HAN PROVOCADO EL ACCIONAR DEL TERCER JINETE DEL APOCALIPSIS EL CUAL ATACA A LOS GRANEROS Y DESPENSAS (ZONAS PRODUCTORAS DE ALIMENTOS) DE TODO EL MUNDO …. UCRANIA Y RUSIA EXPORTAN MAYORITARIAMENTE ; TRIGO, CEBADA,… FERTILIZANTES… ACEITE DE GIRASOL…..QUE PAIS ES EL PRIMER EXPORTADOR DE VINO EN EL MUNDO ACTUALMENTE? ….  AQUEL NO SERA TOCADO AUN …..

 

Zack Saetonious

 

LA AFECTACION AL ACEITE DE GIRASOL UCRANIANO DEBIDO A LA GUERRA POSIBILITA QUE OTROS PAISES EUROPEOS REORIENTEN SUS SEMBRIOS HACIA ESA OPCION DEBIDO A LOS PRECIOS ALTOS QUE ESTA TENIENDO EN EL MERCADO….LO QUE SE TRADUCE QUE EL ACEITE AUN NO SERA TOCADO POR ESE JINETE APOCALIPTICO.

—————————————————————————————————————————————————————

Los agricultores europeos retoman el cultivo de girasol debido a la guerra en Ucrania

Por Juan Carlos De Santos Pascual  con AFP  •  última actualización: 14/05/2022

La sequía y la guerra en Ucrania está llevando los precios del girasol a máximos históricos. Ahora que su cultivo requiere menos agua y abono que el maíz se está popularizando. Algunos agricultores del resto de Europa están volviendo cultivarlo. De repente vuelve a ser rentable.

La Vendée, en particular, es uno de los departamentos en los que la tendencia es más fuerte, con un aumento de más de 2.500 hectáreas para las oleaginosas y un descenso de 5 a 12.000 hectáreas para el maíz en grano, mientras que las destinadas a forraje se mantienen estables.

Régis Bonnin destaca:»Tomamos la decisión en marzo, especialmente por desgracia debido a la guerra en Ucrania y a la fuerte subida de los precios del girasol. Yo cultivaba girasoles hace 20-25 años. Dejamos el cultivo por las plagas, las palomas, porque había que resembrar, causaba problemas. Con los precios a 300, 350 euros, era un cultivo poco rentable, así que era mejor cultivar maíz, trigo o colza, y lo dejamos de lado durante un tiempo».

Si la crisis se prolonga, otros agricultores podrían seguir su ejemplo. De este modo, se podría compensar la falta de oferta en el mercado interno y obtendrían grandes beneficios.

https://es.euronews.com/2022/05/14/los-agricultores-europeos-retoman-el-cultivo-de-girasol-debido-a-la-guerra-en-ucrania

 

Yosef Arad

QUERODO EGE

PUEDE QUE EL 22 DE MAYO(ONCE ×2) LE TRASPASEN LA AUTORIDAD «DE IURE» A LA ORG@NIZACIÓN MUND1@L DE sat…$ PERO LA «DE FACTO» VA A SEGYUR RESIDIENDO EN UNA POBLACIÓN QUE EN UN 44% ESTÁ ARMADA Y EN DISPOSICIÓN DE USAR ESAS ARMAS.

LKM

BENDICIONES

MARANATHA

https://youtu.be/YfhBtHtqnME

 

EGE

Sí, ya sabes que… Si permitimos a los políticos que violen nuestros derechos en tiempos de crisis, crearán crisis para violar nuestros derechos. Eso allí lo saben bien por eso su defensa a su derecho a portar armas…

 

Abel Real

https://youtu.be/wZbFsFWk__c

GEORGE VAN TASSEL…..

 

Abel Real

https://youtu.be/ZPIJlPcZCJU

El Integratron…. La máquina que fue construida por George Van Tassel…..

 

https://youtu.be/wZbFsFWk__c

HAY SUBTITULOS EN ESPAÑOL….

 

Zack Saetonious

 

Virus de la viruela: la enfermedad más letal podría volver – 22 ABRIL 2020

https://www.youtube.com/watch?v=WfhNSt80xO0

 

Atencion al minuto 3:17 al 3:23……»» LA REALIDAD ES QUE LA VIRUELA SOLO PODRIA VOLVER SI ALGUIEN QUISIERA HACERLA VOLVER»»

 

Zack Saetonious

💥ALERTA EPIDÉMICA💥BROTE MUNDIAL DE VIRUELA DEL MONO ES INMINENTE

https://www.youtube.com/watch?v=0xxtAWQr93g

 

Zack Saetonious

Salmos 86 – Biblia Torres Amat 1825

Oración pidiendo la continuada misericordia de Dios Oración de David.

1 Inclina, Señor, tu oído a mis ruegos, y escúchame, porque me hallo afligido y necesitado.

2 Guarda mi vida, puesto que soy santo. Salva, ¡oh Dios mío!, a este siervo tuyo que tiene puesta en ti su esperanza.

3 Señor, ten misericordia de mí, porque no ceso de clamar a ti todo el día.

4 Consuela el alma de tu siervo, pues a ti, ¡oh Señor!, tengo de continuo elevado mi espíritu.

5 Siendo tú, Señor, como eres, suave, y benigno, y de gran clemencia para con todos los que te invocan,

6 oye propicio, ¡oh Señor!, mi oración, y atiende a la voz de mis ruegos.

7 A ti clamaré el día de mi tribulación, pues tú siempre me has oído benignamente.

8 Ninguno hay entre los dioses que pueda, ¡oh Señor!, parangonarse contigo; ninguno que pueda imitar tus obras.

9 Las naciones todas, cuantas creaste, vendrán, Señor; y postradas ante ti te adorarán, y tributarán gloria a tu Nombre.

10 Porque tú eres el grande; tú el hacedor de maravillas; tú solo eres Dios.

11 Guíame Señor, por tus sendas, y yo caminaré según tu verdad; alégrese mi corazón de modo que respete tu Nombre.

12 Te alabaré, ¡oh Señor Dios mío!, con todo mi corazón y glorificaré eternamente tu Nombre.

13 Porque es grande tu misericordia para conmigo, y has sacado mi alma del infierno profundo.

14 ¡Oh Dios!, han conspirado contra mí los impíos, y una reunión de poderosos ha atentado contra mi vida, sin atender a que tú te hallas presente.

15 Pero tú, Señor Dios, compasivo y benéfico, paciente y misericordiosísimo y veraz,

16 vuelve hacia mí tu rostro, y tenme lástima; da tu imperio a tu siervo, y pon a salvo al hijo de tu esclava.

17 Obra algún prodigio a favor mío, para que los que me aborrecen, vean con confusión suya, cómo tú, ¡oh Señor!, me has socorrido y consolado

 

Al-Wali

La viruela estaba totalmente erradicada, y sólo se mantenían muestras en laboratorios.

 

Al-Wali

Añaden “del mono” y ya los borregos ya no saben que la viruela solamente se conservaba en laboratorios.

 

Yosef Arad

NO PUEDE VOLVER PORQUE NUNCA ESTUVO ZACK.

LA HISTORIA DE LA VIROLOGIA ES UN COMPLETO «BLUFF» ESTAFA TIMO MILONGA ETC ETC.

HACE UNOS MESES SUBÍ AQUÍ UN VIDEO SOBRE UNO DE LOS MÁS GRANDES CIENTÍFICOS ACTUALES EL ALEMÁN DR. STEFAN LANKA QUE DEMOSTRABA QUE PASTEUR FUE UN IMPOSTOR A SUELDO DE JOHN D. ROCKEFELLER QUIEN LE PAGÓ MUY BIEN PARA QUE SE INVENTARA EL «CUENTO CHINOI» DE LOS V1RU$.

EL ,AUTÉNTICO V1RUS DE LA «VIRU3L@» ES LA ACCION COMBINADA DEL ÓXIDO DE GR4F3N0 INOCULADO EN KAKUN@S O INHALADO EN FALSOS PCR’S INGERIDO EN AGUA COMIDA ETC O A TRAVES DE M@SC@RILLAS TAMBIEN GR4F3NAD@S Y LA IRRADIACION POR ONDAS ELECTROMAGNÉTICAS DE ANT3N@S DESDE LAS 3 JE A LAS 5 JE.

LO REPETIRÉ HASTA LA NAUSEA PORQUE AQUI ACUDEN DIARIAMENTE INOCENTES QUE MERECEN SABER LA VERDAD.

AQUI VIDEO SOBRE LA FALACIA DE LA V1ROLOGI@ MODERNA:

https://odysee.com/@Ant%C3%ADtesis:5/definitiva-refutacion-virologia:4

BENDICIONES

 

Yosef Arad

NI VIRU3L@ NI MONO.

GR4F3N0 E IRRADIACIÓN PIR OBDAS ELECTROMAGNÉTICAS DE @NTEN@S A 26 GHZ

BENDICIONES

 

Yosef Arad

NI VIRU3L@ NI MONO.

GR4F3N0 E IRRADIACIÓN PIR OBDAS ELECTROMAGNÉTICAS DE @NTEN@S A 26 GHZ

BENDICIONES

 

Al-Wali

Veo, Yosef, que agarraste una cuerda de la marioneta, y piensas que es la única cuerda que mueve a la marioneta…

 

O múltiples enfermedades inoculadas a través de las vacunas.

 

Maria Jesus

ESTIMADO JOSÉ, INTERESANTE VIDEO, RICARDO DELGADO LO QUE MAS ME HA GUSTADO.

VILL PUERTAS LO QUE MENOS ME HA GUSTADO, NO ME HA GUSTADO SU FORMA DE EXPLICARSE, NI SU CARA, NI SUS EXPRESIONES, Y SOBRE QUE TIENE EL VIRUS C.. V.. D, NO ME LO CREO, COMO TAMPOCO QUE SE HAYA VACUNADO, TODO ES PROPAGANDA  PARA  ANIMAR A LOS TODAVÍA INDECISOS.

BENDICIONES, UN ABRAZO, TKM, MARANATHA, 🙏💙

 

ALEJANDRO

QUERIDO AMIGO DEL ALMA JOSE

 

ME HA SIDO MUY CORTO EL VIDEO PORQUE HE PODIDO VER LO QUE ES EN ESPAÑOL NADA MAS Y LOS PIANISTAS.

 

HABLANDO DE PIANISTAS, NO ME VAN A CREER, PERO TOCABA EL PIANO COMO LO HIZO EL PRIMERO, PERO TUVE QUE DEJAR PORQUE SE ME ACALAMBRABAN LOS DEDOS DE LAS MANOS.

 

SI NO ME CREYERON  HICIERON BIEN, FUE UN CHASCARRILLO.

 

SALUDOS PARA TODOS

 

Maria Jesus

PAZ Y BENDICIONES ESTIMADOS HERMAN@S DE ESE, LKM,

» » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » » ‘

*****DEVASTACIÓN DE LA TIERRA POR LA LANGOSTA*****

* JOEL 1: 1-11

PALABRA DE YHWH QUE VINO A JOEL, HIJO DE PETUEL.

OID ESTO, ANCIANOS, Y ESCUCHAD,  TODOS, LOS MORADORES DE LA TIERRA. ¿HA ACONTECIDO ESTO EN VUESTROS DÍAS, O EN LOS DÍAS DE VUESTROS PADRES?

DE ESTO CONTARÉIS A VUESTROS HIJOS, Y VUESTROS HIJOS A SUS HIJOS,  Y SUS HIJOS A LA OTRA GENERACIÓN.

LO QUE QUEDÓ DE LA ORUGA COMIÓ EL SALTON, Y LO QUE QUEDÓ DEL SALTON COMIÓ EL REVOLTON; Y LA LANGOSTA COMIÓ LO QUE DEL REVOLTON HABÍA QUEDADO.

DESPERTAD, BORRACHOS, Y LLORAD;  GEMID, TODOS LOS QUE BEBÉIS VINO, A CAUSA DEL MOSTO, PORQUE OS HE QUITADO DE VUESTRA BOCA.

PORQUE PUEBLO FUERTE E INNUMERABLE SUBIÓ A MI TIERRA; SUS DIENTES SON DIENTES DE LEÓN, Y SUS MUELAS,  MUELAS DE LEÓN.

ASOLO MI VID, Y DESCORTEZÓ MI HIGUERA; DEL TODO LA DESNUDÓ Y DERRIBÓ; SUS RAMAS QUEDARON BLANCAS.

LLORA TÚ COMO JOVEN VESTIDA DE CILICIO POR EL MARIDO DE SU JUVENTUD.

DESAPARECIÓ DE LA CASA DE YHWH LA OFRENDA Y LA LIBACIÓN; LOS SACERDOTES MINISTROS DE YHWH ESTAN DE DUELO.

EL CAMPO ESTÁ  ASOLADO, SE ENLUTÓ LA TIERRA; PORQUE EL TRIGO FUE DESTRUIDO, SE SECÓ EL MOSTO, SE PERDIÓ EL ACEITE.

CONFUNDÍOS, LABRADORES; GEMID, VIÑEROS,  POR EL TRIGO Y LA CEBADA, PORQUE SE PERDIÓ LA MIES DEL CAMPO.

SEGUIRÁ…….

 

Al-Wali

Siendo niño toqué una vez el piano del marido de una tía mía materna. Tenía fama de ser el mejor abogado de Braga, Lisboa, y por tanto de Portugal. Fue una vez en que fuimos a pasar una noche en una de sus casas (tres o cuatro apartamentos juntos en un caro edificio de Braga, creo recordar). Una casa encantada, y encantadora. Todos pasaron una noche aterradora escuchando ruidos extraños, viendo y sintiendo cosas… Yo dormí solo en una gran habitación que parecía la habitación de un palacio. Dormí plácidamente, y no fue la única casa encantada en la que dormí plácidamente. En aquellos días aún no había sido seducido por el pecado, y antes de ir a dormir toqué el piano como si fuera una caja acústica. Enseguida mi madre se dispuso a darme un par de hostias (sin consagrar), pero aquel gran hombre lo impidió y dijo algo así como “deja que el niño se exprese”. Y como yo ya no me atrevía a tocar el piano a pesar de su insistencia, tocó él. Tocaba muy bien. ¡Un gran hombre!. Me prometió que su reloj sería para mí el día en que muriera. Era un reloj que atraía la imaginación de cualquier niño. Yo le decía que prefería que no me lo diera. A su muerte, mi tía lo malvendió y regaló todo, incluido aquel reloj. Obras de arte a precio de ganga.

Recuerdo que aquel hombre me había regalado una diminuta y gorda lupa que agrandaba las letras de un libro según la desplazabas sobre ellas, y con la que fácilmente podías hacer fuego. Con el tiempo comprendí, por la simbología que recuerdo, que era un masón. Para mí, la persona más interesante, justa y misericordiosa que conocí.

 

ALEJANDRO

 

QUERIDO AMIGO DEL ALMA

 

SEGÚN EL RELOJ DE ISAÍAS, EL ARREBATAMIENTO ES DESPUÉS DE QUE CUMPLE LOS 73 AÑOS ISRAEL Y AL AÑO Y UN POCO MÁS DE TIEMPO

 

ES DECIR AÑO 74 Y ALGO MÁS DE TIEMPO.

 

Y EN LA PARÁBOLA DE LAS VÍRGENES. EL NOVIO SE RETRASA Y LAS VÍRGENES SE DUERMEN.

 

HAY SEGÚN ESTA PARÁBOLA UN PEQUEÑO RETRASO, SUPUESTAMENTE DE HORAS EN LA PARÁBOLA, PERO NO SE CUANTO TIEMPO EN NUESTRO TIEMPO.

 

SUPONGO  QUE ES CORTO TIEMPO POR DEDUCCIÓN QUE DICE LA PARÁBOLA.

 

TAMBIÉN CREO QUE USTEDES MIS HERMANOS NO ESTAN SINTIENDO COMO QUE EL MOMENTO ESTÁ POR LLEGAR.

 

PERO NO SÉ SI SERA PORQUE ESTOY MEDIO MUERTO ESTOY MÁS SENSIBLE, Y ESTOY SINTIENDO QUE EL MOMENTO ESTÁ MUY CERCA DE SER.

 

TENGO DOS FECHAS BÍBLICAS PRÓXIMAS Y LA OTRA ES LEJANA Y NO CREO LLEGAR.

 

LA PRIMERA

 

EL 27 DE MAYO SE CUMPLEN 40 DÍAS DE LA CONMEMORACIÓN DE LA RESURRECCIÓN DE JESUCRISTO

 

DESPUÉS DE LA RESURRECCIÓN  JESÚS ESTUVO 40 DÍAS CON SUS DISCÍPULOS Y LUEGO ASCENDIÓ, FUE ARREBATADO AL CIELO.

 

EL 5 O 6 DE JUNIO ES EL FESTEJO DE PENTECOSTÉS, CUANDO EL ESPÍRITU SANTO COMENZÓ SU MINISTERIO EN LA IGLESIA BAUTIZANDO A LOS 120 PRIMEROS CRISTIANOS, HACIÉNDOLOS NACER DE NUEVO EN EL ESPÍRITU.

 

CREO Y TE MANDE UN MAIL PARA QUE ME INFORMARAS, UNO DE ESOS DÍAS TIENEN PENSADO ACTIVAR EL CERN.

 

SI ESE DÍA OCURRE EL ARREBATAMIENTO LE VAN A ECHAR LA CULPA AL CERN Y NO VAN A SABER PORQUE.

 

SACÁNDOLO DE USO PARA AL FINAL SI CONSIGUEN SU  OBJETIVO DE QUE LES SIRVE EL CERN SI VAN A DOMINAR EL MUNDO IGUAL.

 

LA OTRA FECHA ES DADA POR UN HERMANO POR SUPUESTA E INTERESANTE REVELACIÓN DEL ESPÍRITU SANTO Y SERIA EL  27 DEL 09 DE 2022 A LAS 18 HORAS DE ISRAEL

 

UN DATO MUY PRECISO Y COINCIDENTE CON EL AÑO NUEVO RABINICO

 

Y YOM KIPUR DÍAS DESPUÉS.

 

EL FALSO PROFETA ES MUY POSIBLE QUE SEA UN RABINO QUE CUMPLIO JUSTO ESTE 14 DE MAYO 34 AÑOS Y ES MUY LOADO POR LOS JUDIOS.

 

SEGÚN DICEN SUS PRÉDICAS SON ÚNICAS Y ESTE SI DICE AQUEL ES EL MESÍAS, LA COLECTIVIDAD RELIGIOSA DEL JUDAÍSMO MUNDIAL LE VAN A CREER.

 

POR OTRO LADO HAY ALGUNOS JUDIOS QUE ASEGURAN QUE ESPERAN LA APARICIÓN DE UNA ESTRELLA EN LA CONSTELACIÓN DEL TORO, PORQUE ESTA SERÍA LA SEÑAL PARA ELLOS DE LA APARICIÓN DEL MESÍAS.

 

ASIMISMO LOS MULSUMANES ESTÁN ESPERANDO A SU MESÍAS.

 

Y CREO QUE ESA VA A SER LA COINCIDENCIA PARA AMBOS PUEBLOS RELIGIOSOS Y ENTONCES SIENDO EL MISMO MESÍAS PARA LOS DOS LOS VA A UNIR PROVISORIAMENTE, HACIENDO UN PACTO Y LUEGO A LA MITAD DE LA SEMANA 70 ROMPIÉNDOLO PARA QUE SE CUMPLAN LAS PROFECÍAS.

 

DESPUÉS TODO LO DEMAS QUE ESTAN HACIENDO ESTOS MUÑEQUITOS, TÍTERES DEL ANTICRISTO ES DISTRAERNOS, PREOCUPARNOS, ATEMORIZARNOS, INFLUENCIAR NUESTRAS MENTES, Y SEPARARNOS DE NUESTRO CREADOR

 

Y CREO POR ESO NOS HIZO HINCAPIÉ EN QUE VELEMOS Y OREMOS, PARA NO PERMITIR QUE LAS COSAS QUE PLANEAN Y HAGAN ESTOS TÍTERES NOS SAQUEN DE NUESTRO ESPÍRITU.

 

HABRÁ RUMORES DE GUERRAS Y GUERRAS, HAMBRES, PESTES Y TERREMOTOS, PERO NO OS PERTURBEIS, NOS DIJO JESUS, TODO ESTO TIENE QUE PASAR, PERO SOLO SERA  PRINCIPIOS DE DOLORES.

 

NOS AVISO SI DICEN QUE EL CRISTO ESTÁ POR AQUÍ O POR ALLÁ, QUE NO HAGAMOS CASO, PORQUE ES FALSO.

 

TE CONFIESO QUE CREO QUE EL TIEMPO DEL CUERPO DE CRISTO EN ESTE MUNDO, NO PASARÁ MÁS DE 30 DÍAS.

 

SI NO NOS VAMOS DEL 27 DE MAYO AL 6 DE JUNIO, NO VAN A QUEDAR MUCHOS DÍAS MÁS DESPUÉS DE ESA FECHA.

 

HOY ES SHABAT PARA LOS JUDIOS, ES DIA 20, EL 27 TAMBIÉN A PARTIR DE LAS 18 HORAS SERÁ EL SHABAT, EL SHABAT PARA NOSOTROS EL REPOSO, EL DESCANSO ES JESUCRISTO.

 

VENID A MÍ , TODOS LOS QUE ESTÁN TRABAJADOS Y CANSADOS.

 

HASTA AHORA SÓLO YO, DOY ESTA FECHA COMO POSIBLE, NADIE LA TOMA EN CUENTA.

 

Y LAS ESCRITURAS DICEN QUE VENDRÁ A LA HORA QUE MENOS PENSÁIS.

 

POR ÚLTIMO,

 

NO VEO CERCANA MI MUERTE, VEO CERCANO MI ARREBATAMIENTO.

 

AMEN

 

TKM

 

Zack Saetonious

JOB 38:22-23 BIBLIA DEL OSO 1569

22 Has tu entrado en los theſoros de la nieue? y has viſto los theſoros del granizo?

23 Loqual yo he guardado para el tiempo del auguſtia: para el dia de la guerra y de la batalla?

 

Zack Saetonious

ACASO NO SERAS PACIENTE Y LENTO UN POCO MAS SEÑOR …..AUNQUE SEA UNA HORA O CINCO HORAS? … AUN PUEDE HABER ESPERANZA PARA UNOS CUANTOS EN ESTE MUNDO …. ACASO NO SUJETARAS Y OCULTARAS TU MANO PARA NO CASTIGAR INCLUSO A QUIEN SE HUMILLA ANTE TI?….

————————————————————————————————————————————————————

¡CRISIS EN SRI LANKA = SEÑALES DE LO QUE VIENE! Sin gasolina, sin comida, el país está en bancarrota, políticos golpeados y asesinados, edificios gubernamentales en llamas

18 de mayo de 20226

Los disturbios en Sri Lanka son una señal de lo que vendrá…

PM House en Sri Lanka:

Daniel Alonso

@danialonpri

🔥Esto le ha pasado a los juguetes del Primer Ministro de Sri Lanka,Mahinda Rajapaksa

Es un aviso INTERNACIONAL a TODOS los políticos ante la crisis que viene

Ya podéis correr esbirros de la élite oscura,ni ELLOS ni NOSOTROS tendremos piedad de vosotros

https://twitter.com/i/status/1525322875640680448

Las élites occidentales no entienden que lo que está pasando en Sri Lanka es matemáticamente inevitable a escala global.

Un grupo de políticos desnudos y en el suelo rogando por sus vidas:

https://twitter.com/i/status/1526660318692360192

Si crea inflación aumentando los precios y disminuye el poder adquisitivo de la clase contribuyente a través de la supresión de salarios, tomando trabajos en el extranjero y la automatización, y evadiendo impuestos al deslocalizar la riqueza corporativa en lugar de pagar impuestos, crea pobreza y desesperación que finalmente estalla en forma de violencia. .

Político perseguido y golpeado por la multitud:

https://twitter.com/i/status/1526202406316523520

Aumento de precios + disminución del poder adquisitivo = pobreza inevitable, seguida de violencia.

Político siendo apedreado:

https://twitter.com/i/status/1525227057650835456

No es difícil de entender. Es difícil ver a través de la niebla del dinero sucio.

Políticos corriendo por su vida:

https://twitter.com/i/status/1525100624194437120

Y si no puede ver a través de la niebla del dinero, le resultará aún más difícil vivir a través de la niebla de la guerra.

Políticos y autos de élite tirados al océano:

https://twitter.com/i/status/1524755946517446658

Los políticos de todo el mundo deberían tomar nota de lo que está pasando allí… Porque eso es lo que enfrentarán en los próximos meses…

 

Al-Wali

Otra…

La Oreja De Van Gogh Día Cero (Calidad CD y con letra)

https://youtu.be/arBE7iMpxwI

 

Yosef Arad

QUERIDO NOTARIO Y QUERIDOS HERMANOS DE ESE:

RUAJ HAKODESH HA PUESTO EN MI ESPIRITU/RUAJ EL ACLARAR DE UNA VEZ POR TODAS LA CUESTIÓN DE LAS FECHAS DEL NACIMIENTO Y MUERTE DE NUESTRO REDENTOR YESHUA HAMASHIAJ/JESUS EL MESÍAS, QUIEN FUE EL MISMO ELOHIM ENTREGADO A SI MISMO EN CARNE MORTAL Y RESUCITADO GLORIOSAMENTE EN CUERPO INCORRUPTO AL TERCER DIA SEGUN LAS ESCRITURAS, (LAS AUTENTICAS NO LAS MANIPULADAS TORTICERA E INTENCIONADAMENTE POR LAS FALSAS DOCTRINAS DURANTE 1700 AÑOS).

 

1.-NACIMIENTO DE YESHUA HAMASHIAJ/JESUS EL MESÍAS.

NO HACE FALTA SALIR DE LA BIBLIA PARA CONOCER EL DÍA EXACTO DEL NACIMIENTO DEL REDENTOR.

EN EL LIBRO DEL PROFETA DANIEL SE ESTABLECE UN PERIODO DE SETENTA SEMANAS (DE AÑOS) HASTA LA SEGUNDA VENIDA DEL MASHIAJ/MESIAS.

DE ELLAS PASARIAN 62 SEMANAS HASTA LA VENIDA DEL HIJO DEL HOMBRE LAS CUALES INICIARON CON EL DECRETO DEL REY PERSA ARTAJERHES PARA LA RECONSTRUCCIÓN DE JERUSALÉN,  DATO QUE ENCONTRANOS EN EL LIBRO DE NEHENIAS QUIEN ERA COPERO DE DICHO REY CUANDO EN EL AÑO 20 DE SU REINADO (455 AC) EMITIÓ DICHO DECRETO.

 

COMO SON 62 SEMANAS DE AÑOS (62×7=434 AÑOS)

DANIEL 9:25

«SABE, PUES QUE DESDE LA SALIDA DE LA ORDEN PARA RESTAURAR Y EDIFICAR A JERUSALÉN HASTA EL MESÍAS PRÍNCIPE HABRÁ SIETE SEMANAS Y 62 SEMANAS; SE VOLVERÁ A EDIFICAR LA PLAZA Y EL MURO EN TIEMPOS ANGUSTIOSOS»

 

POR LO TANTO SABIENDO QUE EL AÑO 20 DE ARTAJERJES COINCIDE CON EL 455 AC Y SUMANDOLE 434 AÑOS (62 ×7 SEMANAS) Y LOS SIETE PERIODOS DE AÑOS ADICIONALES (PORQUE EN EL CALENDARIO HEBREO SE CONTABAN LOS AÑOS POR PERIODOS DE 7 YA QUE EN EL 7@ ERA «SHEMITA» Y NO SE COSECHABA NADA Y SE LIBERABA A ESCLAVOS Y SE CANCELABAN DEUDAS).

 

ASI LOS 434 AÑOS EMPEZARON A CONTAR DESDE EL AÑO 450 AC (PORQUE ESE FUE EL AÑO «SHEMITA» MÁS CERCANO AL 455 AC AÑO DEL EDICTO DE ARTAJERJES).

ENTONCES TENEMOS QUE -450 +434= -16.

Y SUMANDOLE A ESTE LOS 9 «PAQUETES» DE AÑOS SHEMITA DE DICHO PERIODO TENEMOS QUE -16 +(-9)= -7.

ES DECIR EL AÑO -7 O 7 AC.

 

Y AQUI ES DONDE SE EQUIVOCÓ EL FRAILE «DIONISIO «EL EXIGUO» PORQUE EN EL AÑO 525 DC POR ENCARGO DE JUSTINIANO CALCULÓ MAL EL AÑO DEL NACIMIENTO DE YESHUA/JESUCRISTO YA QUE NO TUVO EN CUENTA QUE EL AÑO 0 NUNCA EXISTIÓ.

Y TAMPOCO TUVO EN CUENTA QUE EL NACIMIENTO SEGÚN PODEMOS ENCONTRAR EN EL EVANGELIO DE LUCAS COINCIDIO CON EL CENSO ANUAL QUE HACÍAN LOS ROMANOS COMO POTENCIA OCUPANTE DE JUDEA Y GALILEA.

 

PUES BIEN, DICHO CENSO SE HACIA SIEMPRE EN OTOÑO.

SI CALCULAMOS 6 MESES DESDE EL NACIMIENTO DE SU PRIMO JUAN EL BAUTISTA (SABEMOS QUE ESTE NACIÓ EN ABRIL PORQUE LA TRIBU A LA QUE PERTENECÍA SU PADRE ZACARÍAS TENIA ASIGNADO EL TURNO DE SERVICIO EN EL TEMPLO EN JULIO, QUE ES CUANDO SE LE APARECIÓ EL ANGEL Y LE DIJO QUE IBA A SER PADRE. NO TENEMOS MAS QUE SUMAR 9 MESES PARA SABER QUE JUAN NACIÓ EN ABRIL.

 

Y COMO EN EL MISMO EVANGELIO SE NOS DICE QUE MIRIAM CONCIBIÓ A YESHUA ESTANDO SU HERMANA EMBARAZADA DE 3 MESES NO HAY MÁS QUE SUMAR 6 MESES DESDE ABRIL Y TENEMOS QUE YESHUA HAMASHIAJ NACIÓ EN OCTUBRE DEL AÑO -5 (5 AC)

EL DÍA TUVO QUE SER NECESARIAMENTE EL 21 (SIETE ×3 O 777 ( DEL MES 7@ (TISHREI) QUE EN EL CALENDARIO JULIANO (VIGENTE EN EL I.ROMANO Y OCCIDENTE HASTA 1582) COINCIDIÓ EN EL 14 (7+7)  (DE OCTUBRE DEL AÑO -5 YA QUE HERODES ORDENÓ EL CENSO DE LOS NIÑOS DE HASTA 2 AÑOS Y MURIÓ EL AÑO -4 POR LO QUE ABARCARIÁ LOS NACIDOS ENTRE EL -6 Y EL. -4)

 

EN RESUMEN LA FECHA DEL NACIMIENTO DE NUESTRO ADON/SEÑOR FUE EL 14 DE OCTUBRE (21 DE TISHREU) DEL -5 O 5 AC

**********&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&_*********!*!!!!!!!!!!!**************

 

2-MUERTE

 

YA LO EXPUSE AQUI UN PAR DE VECES PERO NO PUEDO DEJAR DE DECIRLO UNA VEZ MAS PARA DEMOSTRAR BIBLIA EN MANO LA FALSEDAD M@SONIC@ DEL AÑO 33 Y. DE QUE ESA FUERA LA EDAD A LA QUE MURIÓ YESHUA/JESUCRISTO.

 

EL PUNTO DE PARTIDA ES EL MISMO: EL LIBRO DE NEHEMIAS QUIEN ERA COPERO DE ARTAJERJES Y EN EL AÑO 20@ DE SU REINADO (455 AC) EMITE EL EDICTO DE LA RECONSTRUCCIÓN DE JERUSALÉN.

 

SI SUMAMOS LAS 69 SEMANAS DE AÑOS DE DANIEL A ESTA CIFRA (69×7=483) NOS DA -455 + 483= 28.

VEINTIOCHO Y NO EL M@SONICO Y S@T@NICO 33 (LA PIRAMIDE M@SONIC@ DEL ONCE MULTIPLICADA POR SUS TRES LADOS O ÁNGULOS)

 

ES DECIR YESHUA/JESÚS MURIÓ (COMO NO PODÍA SER DE OTRA FORMA PARA SEGUIR CUMPLIENDO EL PATRÓN DEL NUNERO 7 O NUMERO DE EKOHIN) EL MIÉRCOLES 14 (7+7) DEL MES DE AVIV DEL AÑO 28 (7+7+7+7) DE NUESTRA ERA. VISPERA DE LA FIESTA DE PESAJ EXPIRANDO EXACTAMENTE A LA HORA DEL 3@ SACRIFICIO DEL CORDERO PASCUAL LAS 3 PM QUE EN EL CALENDARIO JULIANO ENTONCES VIGENTE CORRESPONDIÓ AL MIÉRCOLES 3 DE ABRIL (3+4=7) DE DICHO AÑO 28 DC.

 

Y LA RESURRECCIÓN TUVO LUGAR EN LA FIESTA HEBREA DEL «OMER RESHIT» EN ALGÚN MOMENTO DE LA NOCHE ENTRE EL VIERNES 16 Y EL SHABAT SEMANAL DEL 17 DE AVIV (ENTRE EL VIERNES 5 Y EL SABADO 6 DE ABRIL) ANTES DEL AMANECER PARA NO QUEBRANTAR EL ANGEL QUE REMOVIÓ LA PIEDRA DE LA SEPULTURA EL SAGRADO DIA DE REPOSO.

 

EN CONSECUENCIA YESHUA HAMASHIAJ/JESUCRISTO MURIÓ A LOS TREINTA Y UN AÑOS Y MEDIO (5 AC-28 DC) Y SU ÚLTIMO CUMPLEAÑOS FUE EL 14 DE OCTUBRE DEL AÑO 27 DC.

 

DEL AÑO -5 AL 27 HAY 32 YA LO SÉ PERO ES QUE NUNCA EXISTIÓ EL AÑO CERO SINO QUE SE PASO DEL AÑO -1 AL AÑO 1.

POR TANTO 32-1= 31.

Y NUNCA EL M@SONICO Y S@T@NICO 33.

 

ESTA ES LA VERDAD SEÑORES QUE EL @DVERS@RIO HA VENIDO OCULTANDO A LA HUMANIDAD CON TRETAS ARTIFICIOS Y MANIPULACIÓN DE LAS SAGRADAS ESCRITURAS DURANTE LOS ULTIMOS DOS MIL AÑOS.

 

TODA LA GLORIA /KOL HA KAVOD YEESHUA HAMASHIAJ QUIEN ES ELOHIM YHW TZEVAOT/YHWH DE LOS EJERCITOS.

HALLELUYA

Lkm

BENDICIONES

MARANATHA

 

Yosef Arad

NO ARTURO

ES QUE YA NO PODIAN SUFRAGAR LOS GASTOS DE TRANSPORTE DEL @DR3NOCR0M0.

BENDICIONES

 

Yosef Arad

QUERIDA HERMANA M JESUS:

AQUI HUMOR DE HOY JUEVES/YOM HAMESHI

https://youtu.be/r8GWlQ9DZdc

Lkm

BENDICIONES

MARANATHA

 

Yosef Arad

 

GRACIAS ARTURO

EN MI CASO LA MEJOR PERSONA QUE ME HE ENCONTRADO Y A LA QUE MAS QUISE (DESPUÉS DE MIS PADRES Y MI ESPOSA) FUE UN TIO MIO QUE ERA ATEO.

LKM

 

Yosef Arad

VIL PUERTAS ES UNA POTESTAD D3MONIAC@ DE ALTO RANGO M JESUS

YHWH LO REPRENDA

LKM

 

Yosef Arad

SOMOS LLEVADOS AL DESIERTO

CRECIMIENTO ESPIRITUAL PARTE 1

LA CUENTA DEL OMER

https://youtu.be/GfjE3HyGwRI

Lkm

BENDICIONES

MARANATHA

 

Yosef Arad

SOMOS LLEVADOS AL DESIERTO

CRECIMIENTO ESPIRITUAL PARTE 1

LA CUENTA DEL OMER

https://youtu.be/GfjE3HyGwRI

Lkm

BENDICIONES

MARANATHA

 

Yosef Arad

EL «v@tic@no» Y SUS CAMBISTAS DE D1N3RO  A PUNTO DE DERRUMBAR EL SISTEMA FINANCIERO

https://youtu.be/KoHA3Lz8l38

LKM

BENDICIONES

MARANATHA

 

Yosef Arad

«EL SECRETO DE DIOS

LA SECUENCIA FIBONACCI

https://youtu.be/0GQ3ARINoIA

Lkm

BENDICIONES

MARANATHA

 

Yosef Arad

REFUTANDO A «TEOLOGIA PAULINA»

¿QUIENES SON LOS JUDAIZANTES?

https://youtu.be/_QwjqGgtqm0

LKM

 

Zack Saetonious

 

SOPLAD SOLANO, SOPLAD Y TU TAMBIEN AUSTRO … ES EL TIEMPO

———————————————————————————————————————————————————

Gigante nube de polvo del Sahara llegará a la Costa del Golfo de EE.UU. este fin de semana

19 de mayo de 2022

El polvo del desierto del Sahara generalmente viaja a través del Atlántico hacia los Estados Unidos de mayo a agosto y puede causar riesgos para la salud.

Una nube de polvo transatlántica del Sahara, la primera en 2022, se dirige hacia los Estados Unidos y barrerá los estados de la costa del Golfo tan pronto como este fin de semana.

El polvo todavía estaba sobre el Atlántico hasta el martes, y las proyecciones muestran que la nube de polvo engullirá el Caribe antes de llegar a las costas de la costa del Golfo de EE. UU.

La mayoría de las partículas flotan alrededor de una milla sobre la superficie de la Tierra en una capa de aproximadamente 2 a 2.5 millas de espesor, conocida como la Capa de Aire del Sahara.

Las partículas pueden presentar riesgos para la salud y pueden provocar alergias y asma en personas sensibles.

“ La mayoría de nosotros simplemente notamos que el cielo se vuelve de un gris brumoso, que es especialmente notable al amanecer y al atardecer”, dijo un meteorólogo.

Hay desacuerdo entre los pronósticos sobre si las partículas de la última nube de polvo del Sahara llegarán a la costa occidental del Golfo.

El modelo de la NASA muestra algo de polvo en los cielos de Louisiana y Texas el domingo, mientras que el modelo de Copernicus proyecta que el polvo se disipará antes de que llegue a los Estados Unidos, excepto en el sur de Florida, según Jesse Ferrell, editor meteorológico sénior de AccuWeather.

https://www.youtube.com/watch?v=HW48DmkJShk

Los efectos de la nube de polvo del Sahara podrían mitigarse en Texas por la posible lluvia a lo largo de un frente frío que se aproxima.

Se prevé que los efectos de la primera nube de polvo del Sahara de 2022 sean leves, especialmente en comparación con la tormenta de polvo de Godzilla en 2020 , que podrían ver los astronautas en la Estación Espacial Internacional. Casi 24 toneladas de polvo fueron transportadas a través del Océano Atlántico desde el desierto del Sahara en 2020.

Es probable que el mayor impacto sean los cielos nublados y el color adicional para los amaneceres y atardeceres.

https://www.accuweather.com/en/health-wellness/saharan-dust-cloud-over-the-atlantic-may-reach-gulf-coast-by-weekend/1188632?partner=web_patch_adc

https://patch.com/texas/houston/saharan-dust-cloud-could-reach-u-s-gulf-coast-weekend

 

 

Maria Jesus

CONTINUACIÓN DE *JOEL 1: 1-11

* 1: 12-20

LA VID ESTA SECA, Y PERECIO LA HIGUERA; EL GRANADO TAMBIÉN,  LA PALMERA Y EL MANZANO;  TODOS LOS ÁRBOLES DEL CAMPO SE SECARON, POR LO CUAL SE EXTINGUIÓ EL GOZO DE LOS HIJOS DE LOS HOMBRES.

CEÑIOS Y LAMENTAD, SACERDOTES; GEMID, MINISTROS DEL ALTAR; VENID, DORMID EN CILICIO, MINISTROS DE MI DIOS; PORQUE QUITADA ES DE LA CASA DE VUESTRO DIOS LA OFRENDA Y LA LIBACIÓN.

PROCLAMAD AYUNO, CONVOCAD A ASAMBLEA; CONGREGAD A LOS ANCIANOS Y A TODOS LOS MORADORES DE LA TIERRA EN LA CASA DE YHWH VUESTRO DIOS, Y CLAMAD A YHWH.

¡AY DEL DÍA! PORQUE CERCANO ESTÁ EL DÍA DE YHWH, Y VENDRÁ COMO DESTRUCCIÓN POR EL TODO PODEROSO.

¿NO FUE ARREBATADO EL ALIMENTO DE DELANTE DE NUESTROS OJOS, LA ALEGRÍA Y EL PLACER DE DELANTE DE  LA  CASA DE NUESTRO DIOS?

EL GRANO SE PUDRIÓ DEBAJO DE LOS TERRONES, LOS GRANEROS FUERON ASOLADOS, LOS ALFOLÍES DESTRUIDOS; PORQUE SE SECO EL TRIGO.

¡CÓMO GIMIERON LAS BESTIAS!  ¡CUÁN TURBADOS ANDUVIERON LOS HATOS DE LOS BUEYES, PORQUE NO TUVIERON PASTOS! TAMBIÉN FUERON ASOLADOS LOS REBAÑOS DE LAS OVEJAS.

A TI, OH YHWH, CLAMARÉ;} PORQUE FUEGO CONSUMIÓ LOS PASTOS DEL DESIERTO, Y LLAMA ABRASÓ TODOS LOS ÁRBOLES DEL CAMPO.

LAS BESTIAS DEL CAMPO BRAMARÁN TAMBIÉN A TI, PORQUE SE SECARON LOS ARROYOS DE LAS AGUAS, Y FUEGO CONSUMIÓ LAS PRADERAS DEL DESIERTO.

* 2: 1,2,12,13

TOCAD TROMPETA EN SION, Y DAD ALARMA EN MI SANTO MONTE; TIEMBLEN TODOS LOS MORADORES DE LA TIERRA, PORQUE VIENE EL DÍA DE YHWH, PORQUE ESTÁ CERCANO.

DÍA DE TINIEBLAS Y DE OSCURIDAD, DÍA DE NUBE Y DE SOMBRA;…..

POR ESO PUES AHORA, DICE YHWH, CONVERTÍOS A MÍ CON TODO VUESTRO CORAZÓN, CON AYUNO Y LLORO Y LAMENTO.

RASGAD VUESTRO CORAZÓN, Y NO VUESTROS VESTIDOS, Y CONVERTÍOS A YHWH VUESTRO DIOS;

PORQUE MISERICORDIOSO ES Y CLEMENTE, TARDO PARA LA IRA Y GRANDE EN MISERICORDIA, Y QUE SE DUELE DEL CASTIGO.

¿QUIÉN SABE SI VOLVERÁ Y SE ARREPENTIRÁ Y DEJARÁ BENDICIÓN TRAS DE ÉL,……?AMÉN

BENDICIONES ESTIMADOS HERMAN@S, HALLELUYAH!! 🙏💙

NUESTRO SEÑOR JESUCRISTO YESHUA VIENE PRONTO!!!

 

 

 

 

 

Y aquí se acaban los comentarios que he seleccionado esta semana.

 

Recordad también que en 4 años todos muertos, FIN. Eso se cumple en 2026, Ledeshmá Menájem nos dijo que sería el 21 de septiembre del 2026. Alejandro lo reafirmó. Yo José el Notario también estoy de acuerdo con esa fecha.

El Espíritu Santo se lo dijo a sor Paquita el 3 de septiembre del 2019. En siete años todos muertos. Fin.

Ser como santos, pues no sabemos ni el día ni la hora en que Jesús vendrá a buscarnos en la nube de su gloria. Aunque esperamos que el arrebatamiento se produzca en cualquier momento y hasta finales de marzo de 2023.

José de ESE

Ayer tuve una importante revelación que hasta ahora no había visto ni entendido.

El profeta Daniel dice que la Bestia 666 tendrá poder durante una semana y todo el mundo entiende que son 7 años, y todo el mundo dice que son 7 años. Bergoglio lleva en el trono del Vaticano desde el 13 de marzo del 2013. Son ya 9 años como falso profeta, aunque quizás se haya manifestado así desde hace menos tiempo, lo que cuadraría esos 7 años de Daniel.

También todo el mundo entiende, (hasta Rafael Sarmiento que es lo más de lo más, y Roberto Braker), que después del milenio el demonio es soltado y viene la guerra del Armagedón, y el milenio se cuenta tal como está reflejado en Apocalipsis cronológicamente desde el momento que Jesucristo pone sus pies en el monte de los Olivos en Jerusalén.

La verdad es que el demonio se encadenó en el año 1000 y se soltó en el 2000 y la guerra vendrá antes de junio de 2026. Los actores a falta del Anticristo, que ya está entre nosotros, son Xi Jinping y Putin.

En Apocalipsis 13-5 Jesús nos dice desde el cielo, ( y corrige a Daniel), que la Bestia 666 tendrá poder durante 42 meses. O sea tres años y medio. 3.5 años.

Si Jesucristo viene a la tierra a separar la paja del trigo el 21 de septiembre del 2026, la Bestia 666 debe manifestarse antes del 21 de marzo del 2023. Antes de esa fecha nos habremos ido en el arrebatamiento. Queda como mucho 343 (suma 1) días contados desde hoy 11-04-2022. (suma 3).

Entonces o nos vamos en 2022, o nos vamos en marzo del 2023 o antes.

Ahora espero primero el arrebatamiento, luego la salvación y el poder estar junto a nuestro amado Jesucristo primero mil años en otra tierra y otro cielo y luego la eternidad con Él y los hermanos de ESE y los que aman a Cristo, y los que amaron a Cristo.

21-05-2022

10.244 palabras

NOTA DEL NOTARIO.

QUERIDO AMIGO ALEJANDRO

HACE MUCHOS AÑOS, EN 2009, JUAN CARLOS AL QUE LLAMO «EL OBISPO» Y QUE HOY TIENE 89 AÑOS ME DIJO QUE DIOS LE PIDIÓ QUE CREARA LA WEB LA PRIMERA RESURRECCIÓN.

AHÍ TE INSCRIBES EN EL LIBRO DE LA VIDA AQUÍ Y TAMBIÉN EN EL CIELO.

CUANDO SATANÁS LA DESCUBRIÓ ENVIÓ A UN DEMONIO COMO ANÓNIMO O DANIEL LÓPEZ QUE CADA DÍA HACE INSCRIPCIONES FALSAS O SATÁNICAS.

MILAGROSAMENTE TAMBIÉN SE PRODUCEN INSCRIPCIONES BUENAS QUE SON BENDECIDAS POR JESUCRISTO EN EL CIELO.

LA LISTA, VISTA DESDE EL CIELO ES COMO UNA ESCALERA DE CARACOL DONDE SOLO SE VEN COMO RESPLANDECIENTES LAS INSCRIPCIONES BUENAS HECHAS DESDE EL CORAZÓN. COMO LAS FOGATAS EN UNA PRADERA EN UNA NOCHE OSCURA.

JAMÁS CAMBIÉ EL CONTENIDO. ESTÁ COMO CUANDO LA CREÉ. LA PRIMERA INSCRIPCIÓN FUE LA MÍA EL 2009-11-26 A LAS 21:07:32 Y HOY CUANDO TE ESCRIBO  HAY 16.917 INSCRIPCIONES.

ESTA ES LA WEB QUE MÁS MOLESTA A SATANÁS. ES AUTOMÁTICA. NADIE LA CONTROLA. SOLO DESDE LA NOTARÍA DEL CIELO.

¿TE IMAGINAS QUE EL AVIVAMIENTO EMPEZARA POR ESTA WEB?

O ESO, O SE PRODUCIRÁ DESPUÉS DEL ARREBATAMIENTO, EN EL QUINTO SELLO.

NO SE ME OCURREN OTRAS POSIBILIDADES DADO EL NIVEL DE ABORREGAMIENTO GENERAL.

UN GRAN ABRAZO

  1. FÍJATE EN LA WEB. GRATIS Y AUTOMÁTICA.

(TE IMAGINAS EL NEGOCIO QUE HARÍA LA I.C.A.R. O CUALQUIER OTRA SECTA CRISTIANA SI FUERA DE ELLA). A 100 DÓLARES LA INSCRIPCIÓN (SI LOS PUEDES PAGAR O A 10 DÓLARES SI ERES POBRE), HARÍA MILES DE MILLONES DE DÓLARES.

Y POR VOLUNTAD DEL SEÑOR JESUCRISTO ES GRATIS.

PERO ES COMO LA SALVACIÓN. LA GENTE DESCONOCE QUE LAS ENTRADAS AL CIELO SON GRATUITAS. SOLO HAY QUE PEDÍRSELAS A JESUCRISTO Y SEGUIR SUS NORMAS.

LO DEL LIBRO DE LA VIDA ES TAMBIÉN IGUAL.

Que Jesús nos escoja y nos arrebate o nos lleve a la primera resurrección.

Inscribirse en el LIBRO DE LA VIDA DEL CIELO AHORA EN LA TIERRA.

LO CERTIFICA JOSÉ EL NOTARIO DE DIOS EN LA TIERRA.

http://primeraresurreccion.com/inscribirse.php

Ver lista hoy 14-02-2022 (16.910 INSCRIPCIONES).

ES SOLO UNA CUESTIÓN DE FE. LA INSCRIPCIÓN ES GRATIS Y ANÓNIMA Y NO SE PUEDE BORRAR, PORQUE SE GRABA TAMBIÉN EN EL CIELO, SOLO LAS BUENAS.

Satanás ha hecho la mitad de las inscripciones y como son negras no se ven en la oscuridad, en cambio las buenas inscripciones, la otra mitad,  brillan con luz propia y se ven desde el cielo, resplandecen en medio de tanta oscuridad. http://primeraresurreccion.com/lista.php

 

 

 

 

 

Esta entrada tiene 127 comentarios

  1. Susana Morales

    Buenas tardes JOSÉ y hermanos de ESE que tengan un excelente fin de semana bendiciones para todos

    1. Susana Morales

      JOSÉ EL ÚNICO PRESIDENTE QUE DIJO QUE NO VA ACEPTAR ENTREGAR SU PAIS A LA OMS ES BOLSONARO. .

  2. Zack Saetonious

    ORBAN LE DA FUERZA A LO COMENTADO 02 EMISIONES DE RADIO ESE ATRAS…… LAS MIGRACIONES MASIVAS Y MUNDIALES …POR LA SOBREVIVENCIA ….. HACIA DONDE?…………………….TRAZADOR DE CAMINO TU SABES….¡ INDICALES POR FAVOR !…. QUE FUE LO QUE ESCRIBISTE CUANDO ESTABAS EN ESTE MUNDO?
    ———————————————————————————————————————————————————
    » NOS ARRASARA UNA »»»+O+L+A —-D+E—–M+I+G+R+A+N+T+E+S+»»» QUE QUIERE SOBREVIVIR «: PRIMER MINISTRO HUNGARO ALERTA DE ESCASEZ DE ALIMENTOS PROVOCADA POR SANCIONES ANTIRRUSAS
    Publicado: 21 may 2022 15:48 GMT
    Viktor Orbán criticó la introducción de sanciones contra Rusia, las que comparó con «una bomba atómica» que podría llevar «a que no podamos alimentar a nuestro pueblo».

    Las sanciones contra Rusia pueden provocar una hambruna en el mundo y una migración masiva sin precedentes, aseguró el primer ministro húngaro, Viktor Orbán, en una rueda de prensa conjunta este sábado con el presidente serbio, Aleksander Vucic.

    «Tenemos 10 millones de personas, y si nos manejamos bien, podemos ganar 20 millones. Por eso no nos conviene la introducción de sanciones contra Rusia, que son igual que una bomba atómica, y llevaría a que no podamos alimentar a nuestro pueblo», indicó Orbán, que alertó que el próximo invierno será «más duro de lo que muchos piensan».

    Según el primer ministro húngaro, la hambruna podría desencadenar una ola migratoria que arrasaría los países a su paso: «Si no conseguimos dar pan a todo el mundo, en Europa nos arrasará una ola de migrantes que quieren sobrevivir. Esta migración no tendrá en cuenta ni a Serbia ni a Hungría, sino que nos desbordará. Si queremos evitarlo, tenemos que proveer de comida a esa gente», agregó.

    «Nuestros héroes en 2021 fueron los médicos, y creo que este año y el próximo los héroes serán nuestros agricultores, que tienen que trabajar en circunstancias muy difíciles y que cambian constantemente», señaló el jefe de Gobierno. «De ustedes depende que tengamos pan en la mesa y que haya hambre», concluyó.

    Asimismo, el secretario general de la ONU, António Guterres, advirtió esta semana que la escasez mundial de alimentos podría golpear el planeta en los próximos meses y señaló que una hambruna global no podría paliarse sin el acceso a alimentos y fertilizantes rusos y bielorrusos, así como al grano ucraniano.

    «Seamos claros: no hay una solución efectiva a la crisis alimentaria sin reintegrar la producción de alimentos de Ucrania, así como los alimentos y fertilizantes producidos por Rusia y Bielorrusia, en los mercados mundiales, a pesar de la guerra», declaró Guterres.

    https://actualidad.rt.com/actualidad/430479-orban-hungria-sanciones-rusia

    1. Zack Saetonious

      HABEIS DESCUBIERTO EL MISTERIO DE LAS CIUDADES REFUGIO?

      1. Al-Wali

        El propósito de las ciudades de refugio era proteger a los homicidas que mataran a alguno por accidente y no a sabiendas. Protegerlos del GOEL, el vengador de la sangre designado.

        1. Zack Saetonious

          JEREMIAS 4:5-6 BIBLIA DEL OSO 1569
          5 Denunciad en Iuda, y hazed oyr en Ieruſalem, y dezid: Sonad trompeta en la tierra, pregonad: JUNTAD, y dezid; JUNTAOS, y entremoſnos en las ciudades fuertes.
          6 Alçad vandera en Sion, JUNTAOS NO OS DETENGAYS: Porque yo hago venir mal dela parte del Aquilon, y quebrantamiento grande.

        2. Zack Saetonious

          ISAIAS 45:20 BIBLIA DEL OSO 1569
          20 Ayũtaos y venid, allegaos todos los remotos delas gentes.-

          SI NO ESTA CLARO …OS DEJO OTRA VERSION
          ISAIAS 45:20 BIBLIA KADOSH ISRAELITA
          20 ¡Congréguense, vengan y reúnanse juntos, ustedes que han escapado de las naciones!

    2. Al-Wali

      Biblia Textual (3ª revisión)
      1ª Corintios 10:13
      No os ha sobrevenido ninguna prueba que no sea humana, pero fiel es Dios, quien no os dejará ser probados más de lo que podéis; antes bien, juntamente con la prueba proveerá también la salida, para que podáis soportar.

      1. Zack Saetonious

        ISAIAS 33:15-16 BIBLIA DEL OSO 1569
        15 Elque camina en juſticias, elque habla rectitud, elque aborrece la ganãcia de violencias. elque ſacude ſus manos de recebir cohecho; elque entapa ſu oreja, por no oyr ſangres: elque aprieta ſus ojos, por no ver cosa mala.
        16 Eſte habitará en las alturas: fortalezas de rocas SERANSU LUGAR DE ACOGIMIENTO; à eſte ſe dará ſu pan, y ſus aguas ſeràn ciertas.

        ISAIAS 33:15-16 BIBLIA KADOSH ISRAELITA
        15 Aquel cuya vida es justa y sus palabras rectas, ° aquel que aborrece la transgresión y la iniquidad, ° aquel que sacude sus manos y las libra de soborno, ° tapa sus oídos contra palabras de sangre ° y cierra sus ojos para no mirar al mal.
        16 Tal persona habitará en las alturas; ° SU REFUGIO, UNA FORTALEZA ENTRE LOS RISCOS, su alimento y bebida en provisión continua. °

          1. Zack Saetonious

            EL TIEMPO SE ACABA HABEIS ENCONTRADO LOS EMPLAZAMIENTOS? …. EN PALESTINA?
            ——————————————————————————————————————-
            DANIEL 11:41 BIBLIA DEL OSO 1569
            41 Y vẽdrá en la tierra deßeable, y muchas prouincias caerán: mas eſtas eſcaparán de ſu mano, EDOM, y MOAB, y lo primero de los hijos de AMMON.

          2. Zack Saetonious

            …… Y JORDANIA?

  3. Maria Jesus

    HOLA ESTIMADO JOSÉ, LO PRIMERO ANTES DE NADA DECIRTE, QUE NO LO HICE EN SU MOMENTO, QUE EL PIANISTA ES UN VIRTUOSO, Y TAMBIÉN EL NIÑO QUE TOCA DE MEMORIA.
    BUENO SOBRE EL VIDEO DE HOY TE DIGO QUE LA NOTICIA DE LA OMS, ES TREMENDAMENTE ALARMANTE, ¿ES POSIBLE QUE TODOS ESOS 190 PAISES AGACHEN LA CABEZA Y DIGAN AMÉN? PUES SI ACTÚAN ASÍ, REALMENTE ESTA HUMANIDAD YA SE HA CONVERTIDO EN MONOS.
    YA NO ME SORPRENDE QUE NOS QUITEN LAS PROPIEDADES, Y NUESTROS DERECHOS, Y TODO LO VALIOSO QUE TENEMOS.
    EN FIN JOSÉ, NOTICIAS IMPORTANTES SOBRE LA GUERRA, Y SOBRE LA REVELACIÓN QUE HA TENIDO YOSEF DEL ESPÍRITU SANTO, SOBRE JESUCRISTO YESHUA.
    UN ABRAZO Y BENDICIONES HERMANO TKM, MARANATHA 🙏💙

    1. Querida Maria Jesus…. si nos quitan (les quitan mas bien) todo …. es porque lo permiten… En realidad el único que tiene poder sobre nosotros.. es DIos… ya que es ÉL el que nos ha dado la vida… El resto de criaturas mortales como nosotros solo tienen el poder que por medio de engaños, avaricia, etc etc.. han conseguido.. Pero ahora mismo lo único valioso que tenemos es nuestra alma.. el resto se puede (y se va a ir totalmente) todo al infierno…. Dios no nos hizo esclavos… en último término es el pecado el que nos ha hecho así… Está el pecado global que hace que el mundo esté como está.. y luego el personal… muchos aun en estos tiempos tienen vidas «felices»… (me incluyo)… porque pese a todos los problemas.. estamos seguros de nuestra victoria en Cristo… y porque muchas «pestes» que afectan a otros.. no nos están afectando porque conocemos la verdad y nos aferramos a ella.

    2. Por otro lado yo comparo la situación actual con gente que camina a oscuras sobre las vías del tren… Viene una luz fuerte y un ruido característico del tren… que los va a arrollar a todos.. Unos pocos se dan cuenta y tratan de advertir a los demás para que se aparten… saben que no pueden detener el tren… para evitar la catástrofe pero sí avisar a cuantos mas puedan «que les tomen en serio» que se aparten cuando aún están a tiempo… Para su sorpresa los tratan de locos.. se ríen de ellos… Pese a tener todas las evidencias de lo que va a pasar delante.. «temblor en las vías, ruido, luz cegadora» etc…aun así.. no se apartan… algo así sienten «sentimos» muchos con la pasada «plandemia» y también con lo que va a venir ahora.. con todos esos que dicen que pronto «todo volverá a lo de antes» y que todo estará bien… el EVANGELIO DE LA PROSPERIDAD.. con el que el enemigo seducirá a millones..

    3. Yosef Arad

      GRACIAS QUERIDA HERMANA M JESUS
      AQUI EN MEXICO HAY UN TREMENDO CALOR Y UNA TERRIBLE SEQUIA
      QUE ELOHIM YHWH SE APIADE DE NOSOTROS
      LKM
      BENDICIONES
      MARANATHA

  4. NTI BIO, la conferencia de Seguridad de Munich realizó un ejercicio ficticio que retrató una pandemia global mortal que involucra una cepa inusual del virus de la viruela del simio que surgió por primera vez en la nación ficticia de Brinia y se extendió por todo el mundo durante 18 meses. NOVIEMBRE 2021..
    https://www.youtube.com/watch?v=6OZwYHoh9u0
    .
    Yosef sí mucho de la medicina moderna es un auténtico TIMO…. pero vamos a ver aquí se plantean varios escenarios. Desde que ahora sí que han soltado un «virus» que afecta gravemente.. hasta que por medio de las kakunas han destrozado el sistema inmune de muchos y ahora están expuestos a muchos problemas que antes eran inocuos… hasta el tema de las radiaciones y grafeno, etc. O quizá es un poco de todo esto.. no lo habéis pensado… Realmente sí existen virus, pero la mayoría no afectan a un sistema inmune sano y a una persona bien alimentada con una buena armonía cuerpo-mente-espíritu… Si ahora empiezan a afectar ya sabemos porqué es..
    .
    Al-Wali, no es casualidad que en la generación con mas acceso a la información de la historia sea también la mas ignorante y borrega en muchos temas, porque?… Porque son víctimas de una «saturación»… un déficit de atención brutal… preparado.. para solo atender a lo que les produce placer o satisfacción instantánea… Por eso pese a tener unos medios que hace 30-40 años soñarían con tener ….. nadie se molesta en investigar.. prefieren que se lo den todo masticado.. o en su defecto .. lo que es todavía peor.. solo entretenimiento vacío.. como series-películas-netflix.. videojuegos, redes sociales y música chatarra… eso es lo que desgraciadamente hacen la mayoría en internet… y un poco de tiempo nada es malo.. pero solo dedicar el tiempo libre a eso.. sí, es una desgracia.
    .
    Al final vivimos en un individualismo absoluto en el que solo pensamos en nuestro entretenimiento, bienestar, etc… machacando a otros para conseguirlo si hace falta.. lo que provocará… todo lo que va a pasar… eso es el «amor al dinero» antes que a Dios que aparece en la Biblia.
    .
    Lo de Iran y la identificación biométrica.. otra prueba mas que todo el mundo es un escenario… solo hay una lucha..el bien contra el mal.. las tinieblas contra la luz…. Muchas naciones contra sus ciudadanos… todos los gobernantes de casi todas las naciones son ilegítimos, satánicos y genocidas..y trabajan y obedecen las ordenes de el dios de este mundo.. que ya sabemos quien es.
    .
    Al-Wali así es… Dios no hará soportar mas de lo necesario a cada uno de nosotros.. el que tiene fé y es justo…. será sacado de aquí pronto.

    1. Yosef Arad

      JAJAJA
      ME LO HAS QUITADO POR LA MANO MI GENERA Ñ😌😌LO PENSE SUBIR MAÑANA
      LKM
      BENDICIONES
      MARANATHA

      1. Querido Yosef… ví este enlace ayer y sí ya lo he guardado para ver todo el vídeo… parece muy interesante.. Desde luego el que no haya visto el engaño y la estafa con 2 años de «cuentagio» de coronacirco… se tragará ahora el virus del mono este.. y luego todo lo demás.. Gracias lo veré entero hoy… Bendiciones…

        1. Al-Wali

          La viruela es mucho más peligrosa que la gripe covidiana. Mucho me temo que van a morir más del 30% de los infectados, y que más de ⅓ de los supervivientes se quedarán ciegos, porque las vacunas covid han dañado los sistemas inmunológicos…

  5. ALEJANDRO

    LA SEÑORA QUE HABLABA EN LOS DIBUJITOS DEL MOVIL, MUY LINDAS PALABRAS, PERO ESO QUE NO IMPORTA CUAL SEA TU DIOS, QUIERE DECIRQUE TU DIOS, PUEDES SER TU MISMO, PUEDE SER SATANAS O MAGOLLA, TIRO TODO A LA MIERCOLE.

    LE DIJE A UN AMIGO QUE AHORA ESTA SONADO CON ESTO DE LA VIRUELA DEL MONO, SE VA A TENER QUE DEJAR DE MASTURBAR SI O SI PARA NO CONTAGIARSE, (AQUI SE LE DICE MASTURBARSE HACERSE LA DEL MONO)

    Y MIRA LA ENERGIA HEOLICA DE ESTE MODO POSITIVO, VAS A TENER VENTILADORES GRATIS PARA EL VERANO Y EN EL INVIERNO HACELE SABOTAJE.

    1. Al-Wali

      Creo que lo que en verdad quiso decir es que no importa cuál sea tu religión. Ella es una componente de “médicos por la verdad”, y por el saludo final, quizá leía un mensaje de Fernando López Mirones…

    2. Yosef Arad

      EXACTO ALEJANDRO
      SI QUE IMPORTA Y MUCHO QUIEN SEA TU «DI-S»
      PORQUE PARA MUCHOS ES EL D1N3RO PARA OTROS SU PAREJA O SU PASTIR ETC ETC
      Y TODOS ESTÁN MUY EQUIVOCADOS PORQUE SÓLO HAY UNO
      EMIHIM YHWH
      LKM
      BENDICIONES
      MARANATHA

    3. Maria Jesus

      HOLA ESTIMADO ALEJANDRO, ESTOY TOTALMENTE DE ACUERDO CONTIGO (MIRA ESTO SE ME HABÍA PASADO POR ALTO DE COMENTARLO). YO TAMBIÉN LO VEO ASÍ, DIOS ES UN DIOS CELOSO, Y NO QUIERE OTROS NOMBRES DE DIOSES JUNTO A ÉL, Y NO LO DIGO YO LO DICE ÉL.
      PORQUE POR ESTA «REGLA DE TRES» TODAS LAS RELIGIONES CON SUS DIOSES CON DIFERENTES NOMBRES CABERÍAN EN EL TABERNACULO DE ÉL, Y ESTO ES ECUMENISMO, LA UNIÓN DE LAS RELIGIONES DEL FALSO PROFETA.
      ASÍ, PUES DEBERIAMOS DE LLAMARLE ELOHIM (EN PLURAL, PORQUE ENGLOBA TODO LO QUE ES), «EL PODEROSO» «EL ETENO» «EL MISERICORDIOSO» «EL QUE HACE JUSTICIA» «EL CREADOR» «EL OMNIPRESENTE» «EL SALVADOR» «EL REDENTOR»»EL SANADOR» TAMBIÉN ESTÁ ESTE OTRO NOMBRE «ADONAY» QUE QUIERE DECIR «SEÑOR DE SEÑORES» Y TAMBIÉN TIENE OTRO «REY DE REYES» OSEA QUE NO SE PUEDE COMPARAR NADA CON TODO ESTO. Y LUEGO HAY OTRO TÍTULO QUE ES SOLO SUYO, PORQUE NO SE DE NINGUNA OTRA RELIGIÓN QUE LO TENGA, Y QUE A ÉL LE GUSTA MUCHO Y ES «PADRE»
      BENDICIONES ESTIMADOS, LKM, MARANATHA!! 🙏💙

      1. Maria Jesus

        P. D. Y NO PODEMOS OLVIDARNOS DE ESTE MUY IMPORTANTE
        YHWH «EL QUE ES Y EL QUE SERÉ» EL ETERNO «YO SOY»
        Y YO AÑADO «» EL ÚNICO «»

        1. Danna

          Amen querida hermana Ma. Jesus, que YHWH la siga bendiciendo LKM : )

          1. Maria Jesus

            ESTIMADA DANNA, BENDICIONES PARA TI TAMBIÉN Y TU FAMILIA, LKM, MARANATHA!! 🙏💙

  6. Guerra y rumores de guerra… PESTES, PLAGAS, HAMBRE, ETC… ahí estan ya todas las señales. Que fue el «corona-timo» el principio de la prueba… que desgraciadamente muchos no han pasado y probablemente se tengan que quedar aquí…. aunque solo Dios sabe lo que está en los corazones de cada uno de sus hijos.
    .
    https://www.youtube.com/watch?v=CcRtubKG1iI
    .
    .
    La «viruela» del mono acabó con todo 2022
    https://www.youtube.com/watch?v=iUsQzaOdTR8
    .
    .
    https://www.youtube.com/watch?v=L3lN6lslPrU
    https://www.youtube.com/watch?v=PJhwt0QOWa0

  7. Resumen: DOCUMENTO DE 2021 HABLABA DE UNA PANDEMIA DE VIRUS DE SIMIO DESATADA EN MAYO DE 2022. PREVEÍA 271MILLONES DE MUERTOS.

    1. Yosef Arad

      SON CAPACES DE ESO Y DE MUCHO MAS CON TAL DE NO MENCIONAR LA VERDADERO CAUSABTE:EL ÓXIDO DE GR4F3N0 (R) Y SU INTERACCIÓN CON LAS ONDAS ELECTROMAGNÉTICAS DE LAS @NTEN@S

  8. Aclama al Señor, tierra entera,
    servid al Señor con alegría,
    entrad en su presencia con vítores.
    R/. Aclama al Señor, tierra entera.

    Sabed que el Señor es Dios:
    que él nos hizo y somos suyos,
    su pueblo y ovejas de su rebaño.
    R/. Aclama al Señor, tierra entera.

    El Señor es bueno,
    su misericordia es eterna,
    su fidelidad por todas las edades.
    R/. Aclama al Señor, tierra entera.
    .
    Juan 15, 18-21

    En aquel tiempo, dijo Jesús a sus discípulos:
    «Si el mundo os odia, sabed que me ha odiado a mí antes que a vosotros.
    Si fuerais del mundo, el mundo os amaría como cosa suya, pero como no sois del mundo, sino que yo os he escogido sacándoos del mundo, por eso el mundo os odia.
    Recordad lo que os dije: “No es el siervo más que su amo”. Si a mí me han perseguido, también a vosotros os perseguirán; si han guardado mi palabra, también guardarán la vuestra.
    Y todo eso lo harán con vosotros a causa de mi nombre, porque no conocen al que me envió».

  9. Zack Saetonious

    La próxima catástrofe alimentaria: Ucrania dice que las exportaciones de granos de mayo cayeron más del 60% en comparación con 2021 en la última señal alarmante de la crisis alimentaria internacional
    20 de mayo de 2022

    Ucrania reportó una disminución alarmante en las exportaciones de granos el jueves y los precios del trigo alcanzaron niveles récord esta semana, los últimos indicadores de que la invasión rusa de Ucrania amenaza la seguridad alimentaria de millones de personas en todo el mundo.

    https://imgur.com/a/hqLrRnw

    Las exportaciones de granos de Ucrania han bajado un 64% en lo que va de mayo en comparación con el mismo período del año pasado, dijo el jueves el ministerio de agricultura del país según Interfax Ucrania.

    Conocido como uno de los graneros del mundo por su producción agrícola, Ucrania representó el 10% de las exportaciones mundiales de trigo en 2021, según las Naciones Unidas, mientras que Rusia produjo alrededor del 17% de todo el trigo a nivel mundial.

    Los puertos de Ucrania han suspendido sus actividades desde que comenzó la guerra debido a los bloqueos rusos, y la ONU estima que alrededor de 20 millones de toneladas de granos cosechados están atrapadas en el país.

    Los bloqueos de puertos causarán la muerte de millones si continúan, dijo David Beasley, jefe del Programa Mundial de Alimentos de las Naciones Unidas, a CNN la semana pasada, ya que los países a nivel mundial dependen de Ucrania, también uno de los principales exportadores de maíz y aceite y harina de girasol. para las necesidades básicas de nutrición.

    Los futuros de trigo subieron a máximos históricos esta semana después de que India restringiera las exportaciones de la materia prima en medio de una ola de calor, y los precios del trigo aumentaron más del 60% este año, lo que contribuyó a lo que la ONU estima es un aumento de un tercio en los precios de los alimentos a nivel mundial en el año pasado.

    El hambre mundial está en un «nuevo máximo», dijo el jueves el secretario general de la ONU, António Guterres, y estimó que «decenas de millones» de personas en todo el mundo «se acercarán a la inseguridad alimentaria, seguida de desnutrición, hambre masiva y hambruna, en una crisis que podría durar durante años.»

    Beasley dijo el miércoles en un comunicado en Twitter: “No abrir los puertos en Ucrania será una declaración de guerra a la seguridad alimentaria mundial…. Es absolutamente esencial que permitamos que se abran estos puertos porque no se trata solo de Ucrania; se trata de los más pobres de los pobres en todo el mundo que están al borde de la inanición”.

    Unos 13,6 millones. Así es como muchos niños en todo el mundo sufren emaciación severa, una forma de desnutrición que debilita significativamente el sistema inmunológico, dijo el martes la agencia humanitaria de la ONU para la infancia, vinculando el aumento «catastrófico» de la desnutrición con la guerra en Ucrania.

    Ucrania es el quinto mayor exportador mundial de trigo, el cuarto mayor exportador de maíz y el principal exportador de aceite y harina de girasol, según datos del Departamento de Agricultura de EE. UU.

    Los países de todo el mundo dependen de Ucrania para el grano utilizado para pan, pasta y productos envasados: Egipto es el principal importador de trigo ucraniano, y países como Líbano y Pakistán obtienen la mayoría de su trigo de Ucrania.

    El trigo ucraniano cumple un papel fundamental en los esfuerzos humanitarios, ya que aproximadamente la mitad del trigo del Programa Mundial de Alimentos proviene del país.

    https://www.forbes.com/sites/dereksaul/2022/05/19/ukraine-says-may-grain-exports-down-more-than-60-compared-to-2021-in-latest-alarming-sign-of-international-food-crisis/?sh=1b2c79442cc6

    1. Zack Saetonious

      El caso es que en un afan de bloquear el ingreso de la flota Rusa del Mar Negro Zelenskyy ordeno minar las aguas adyacentes a sus ciudades portuarias con sus cargueros de trigo cargados y no les dieron tiempo necesario de levar anclas y dirigirse a altamar…. se hizo el mismo la trampa y con ello arrastro a todo el planeta……se encontro minas ucranianas en Turquia que la marea alta del mar negro arrastro hasta sus costas….

      1. Yosef Arad

        PERO SI ES UN COMICO(Y MALO) ¿COMO PUEDE TENER ESOS CONOCIMIENTOS DE INGENIERÍA NAVAL Y MILITAR?
        BENDICIONES

        1. Zack Saetonious

          Acaso el gobierno se centra en una sola persona?…. Por eso tiene un gabinete de ministros a quienes delega responsabilidad en las areas que encarga administrar

    1. Yosef Arad

      EL CAMINO LO INICIARON HACE MUCHOS AÑOS QUERIDO EGE
      LA PRUEBA ES QUE TA HAT HIBRIDOS HASTA DE 5@ GENERACIÓN.
      LO DICE FRAN PAREJO QYE AUNQUE ESTÁ EN LA «NEW AGE» SABE MUCHO DE ESTO
      «Las autoridades sanitarias advierten pero NO TIENEN NINGUNA AUTORIDAD PARA OBLIGAR»
      https://youtu.be/0zzRFYrAaek
      LKM
      BENDICIONES
      MARANATHA

  10. Zack Saetonious

    VERGUENZA, VERGUENZA …..CULPABLE,….. CULPABLE…………. MI IRA SE ENCIENDE……..
    ———————————————————————————————————————————————————
    SIGA TECHNOLOGIES Y BAVARIAN NORDIC TIENEN CONTRATOS OFICIALES CON NACIONES DEL PRIMER MUNDO COMO ESTADOS UNIDOS Y EUROPEOS NO REVELADOS PARA LA PRODUCCION DE VACUNAS CONTRA LA VIRUELA DEL MONO A PARTIR DEL 12 DE MAYO, POCOS DIAS ANTES DE QUE COMENZARA EL BROTE…………….
    http://imgur.com/a/5BkHsJ1

    1. Zack Saetonious

      SALGAN DE SUIZA ,,,, HUYAN DE ESA MALDITA TIERRA…. CUANTO ANTES

    2. Querido Zack recordemos estas sabias palabras del PADRE.. Cuantos desprecios a los que intentamos avisar de todo esto encontramos «del mundo» … cuanto se trató de ignorantes y anti-CIENCIA a todo el que levantó la voz en contra de la aberración de pinchar indiscriminadamente el «brebaje» experimental a millones…. bueno pues como dice Jose … Dios castiga y no da voces..
      .
      Juan 8:31-38
      .
      La verdad os hará libres
      31 Dijo entonces Jesús a los judíos que habían creído en él: Si vosotros permaneciereis en mi palabra, seréis verdaderamente mis discípulos; 32 y conoceréis la verdad, y la verdad os hará libres. 33 Le respondieron: Linaje de Abraham somos, y jamás hemos sido esclavos de nadie. ¿Cómo dices tú: Seréis libres?

      34 Jesús les respondió: De cierto, de cierto os digo, que todo aquel que hace pecado, esclavo es del pecado. 35 Y el esclavo no queda en la casa para siempre; el hijo sí queda para siempre. 36 Así que, si el Hijo os libertare, seréis verdaderamente libres. 37 Sé que sois descendientes de Abraham; pero procuráis matarme, porque mi palabra no halla cabida en vosotros. 38 Yo hablo lo que he visto cerca del Padre; y vosotros hacéis lo que habéis oído cerca de vuestro padre.

  11. Zack Saetonious

    La OMS cambió recientemente la hoja informativa de la viruela del mono. Aquí hay una descripción completa de lo que agregaron y eliminaron (abra la imagen a continuación en una nueva ventana para leer mejor)…
    https://imgur.com/a/xxvGTrA

    1. Yosef Arad

      RAZON DE MÁS PARA ACREDITAR CSU FALSEDAD
      BENDICIONES
      MARANATHA

  12. En la propia massMierda… parece de película de terror…
    .
    EURONEWS
    https://es.euronews.com/2021/01/12/covid-19-que-ingredientes-componen-la-vacuna-de-astrazeneca-y-la-universidad-de-oxford
    .
    Adenovirus de resfriado de chimpancé modificado genéticamente
    El ingrediente principal de la vacuna de AstraZeneca y la Universidad de Oxford es un adenovirus causante del resfriado en chimpancés, modificado genéticamente para que no pueda desarrollarse y reproducirse en nuestro cuerpo.

    Los adenovirus son una familia muy común de virus que causan diversas patologías tanto en humanos como en animales.

    Así de entrada no suena muy atractivo, pero justamente esta tecnología se viene desarrollando desde hace años -mientras que el ARN mensajero sintético de Pfizer y Moderna es completamente nuevo- y es mucho más estable que sus competidoras.

    La vacuna de la Universidad de Oxford y AstraZeneca también reproduce, como las otras dos vacunas, la secuencia genética de la proteína S del nuevo coronavirus, la espiga que utiliza el virus para invadir nuestras células.

    El sistema inmune recibe la información y aprende a defenderse frente al COVID-19 cuando queda expuesto creando anticuerpos neutralizantes y una respuesta de las células T del sistema inmunitario»
    .
    https://www.ondacero.es/noticias/sociedad/adenovirus-41-principal-sospechoso-casos-hepatitis-infantil-sintomas-todo-que-sabe-enfermedad_20220511627b8d6c75d99f00010da356.html

  13. Zack Saetonious

    UN GUERRERO HA SALIDO AL FRENTE …. HAY DE QUIEN LE HAGA DAÑO ….
    ———————————————————————————————————————————————————-
    ACTUALIZACIÓN DE COVID: ¿Cuál es la verdad?
    Categoría: Infección

    Tipo de artículo: Editorial

    Russell L Blaylock
    Neurocirujano jubilado, Theoretical Neuroscience Research, LLC, Ridgeland, Mississippi, Estados Unidos.
    Dirección de correspondencia:
    Russell L. Blaylock, Theoretical Neuroscience Research, LLC, Ridgeland, Mississippi, Estados Unidos.

    DOI: 10.25259/SNI_150_2022

    Copyright: © 2022 Surgical Neurology International Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution-Non Commercial-Share Alike 4.0, que permite a otros remezclar, transformar y desarrollar el trabajo sin fines comerciales, como siempre que se acredite al autor y las nuevas creaciones se licencien bajo los mismos términos.
    Cómo citar este artículo: Blaylock RL. ACTUALIZACIÓN COVID: ¿Cuál es la verdad?. Surg Neurol Int 22-abr-2022;13:167

    Cómo citar esta URL: Blaylock RL. ACTUALIZACIÓN COVID: ¿Cuál es la verdad?. Surg Neurol Int 22-abr-2022;13:167. Disponible en: https://surgicalneurologyint.com/surgicalint-articles/covid-update-what-is-the-truth/

    Fecha de envío
    06-feb-2022

    Fecha de Aceptación
    11-feb-2022

    Fecha de publicación
    22-abr-2022

    Páginas vistas
    6.821

    La pandemia de COVID-19 es uno de los eventos de enfermedades infecciosas más manipulados de la historia, caracterizado por mentiras oficiales en una corriente interminable dirigida por burocracias gubernamentales, asociaciones médicas, juntas médicas, medios de comunicación y agencias internacionales.[ 3 , 6 , 57 ] Hemos sido testigos de una larga lista de intrusiones sin precedentes en la práctica médica, incluidos ataques a expertos médicos, destrucción de carreras médicas entre médicos que se niegan a participar en el asesinato de sus pacientes y una reglamentación masiva de la atención médica, dirigida por personas no calificadas con una enorme riqueza. , poder e influencia.

    Por primera vez en la historia de los Estados Unidos, un presidente, gobernadores, alcaldes, administradores de hospitales y burócratas federales están determinando tratamientos médicos basados ​​no en información científica precisa o incluso basada en la experiencia, sino para forzar la aceptación de formas especiales de atención y «prevención». —incluido el remdesivir, el uso de respiradores y, en última instancia, una serie de vacunas de ARN mensajero esencialmente no probadas. Por primera vez en la historia del tratamiento médico, los protocolos no se formulan en función de la experiencia de los médicos que tratan con éxito a la mayor cantidad de pacientes, sino de personas y burocracias que nunca han tratado a un solo paciente, incluidos Anthony Fauci, Bill Gates, EcoHealth. Alliance, los CDC, la OMS, los funcionarios estatales de salud pública y los administradores de hospitales.[ 23 , 38 ]

    Los medios de comunicación (TV, periódicos, revistas, etc.), las sociedades médicas, los consejos médicos estatales y los propietarios de las redes sociales se han designado a sí mismos como la única fuente de información sobre esta llamada “pandemia”. Se han eliminado sitios web, se ha satanizado a médicos clínicos altamente acreditados y experimentados y a expertos científicos en el campo de las enfermedades infecciosas, se han destruido carreras y toda la información disidente se ha etiquetado como «desinformación» y «mentiras peligrosas», incluso cuando proviene de los mejores expertos. en los campos de virología, enfermedades infecciosas, cuidados críticos pulmonares y epidemiología. Estos apagones de la verdad ocurren incluso cuando esta información está respaldada por extensas citas científicas de algunos de los especialistas médicos más calificados del mundo.[ 23 ] Increíblemente, incluso las personas, como el Dr. Michael Yeadon, un exdirector científico jubilado y vicepresidente de la división científica de la compañía farmacéutica Pfizer en el Reino Unido, que acusó a la compañía de fabricar una vacuna extremadamente peligrosa, son ignoradas y demonizado Además, él, junto con otros científicos altamente calificados, han declarado que nadie debería tomar esta vacuna.

    El Dr. Peter McCullough, uno de los expertos más citados en su campo, que ha tratado con éxito a más de 2000 pacientes con COVID mediante el uso de un protocolo de tratamiento temprano (que los supuestos expertos ignoraron por completo), ha sido víctima de un ataque particularmente violento. por aquellos que se benefician económicamente de las vacunas. Ha publicado sus resultados en revistas revisadas por pares, informando una reducción del 80 % en las hospitalizaciones y una reducción del 75 % en las muertes mediante el uso de un tratamiento temprano.[ 44 ] A pesar de esto, está bajo una serie implacable de ataques por parte de los controladores de información, ninguno de los cuales ha tratado a un solo paciente.

    Ni Anthony Fauci, los CDC, la OMS ni ningún establecimiento médico gubernamental han ofrecido nunca ningún tratamiento temprano que no sea Tylenol, hidratación y llamar a una ambulancia una vez que tenga dificultad para respirar. Esto no tiene precedentes en toda la historia de la atención médica, ya que el tratamiento temprano de infecciones es fundamental para salvar vidas y prevenir complicaciones graves. Estas organizaciones médicas y perros falderos federales no solo ni siquiera sugirieron un tratamiento temprano, sino que atacaron a cualquiera que intentara iniciar dicho tratamiento con todas las armas a su disposición: pérdida de la licencia, eliminación de los privilegios del hospital, vergüenza, destrucción de la reputación e incluso arresto. [ 2 ]

    Un buen ejemplo de este ultraje contra la libertad de expresión y el suministro de información de consentimiento informado es la reciente suspensión por parte de la junta médica de Maine de la licencia médica de la Dra. Meryl Nass y la orden de someterse a una evaluación psiquiátrica por prescribir ivermectina y compartir su experiencia. en este campo.[ 9 , sesenta y cinco ] Conozco personalmente a la Dra. Nass y puedo dar fe de su integridad, brillantez y dedicación a la verdad. Sus credenciales científicas son impecables. Este comportamiento de una junta de licencias médicas recuerda la metodología de la KGB soviética durante el período en que los disidentes eran encarcelados en gulags psiquiátricos para silenciar su disidencia.

    OTROS ATAQUES SIN PRECEDENTES
    Otra táctica sin precedentes es eliminar a los médicos disidentes de sus puestos como editores y revisores de revistas y retirar sus artículos científicos de las revistas, incluso después de que estos artículos se hayan impreso. Hasta este evento pandémico, nunca había visto tantos artículos de revistas siendo retractados, la gran mayoría promoviendo alternativas al dogma oficial, especialmente si los artículos cuestionan la seguridad de las vacunas. Normalmente, un trabajo o estudio enviado es revisado por expertos en el campo, lo que se denomina revisión por pares. Estas revisiones pueden ser bastante intensas y puntillosas en los detalles, insistiendo en que todos los errores dentro del artículo se corrijan antes de la publicación. Por lo tanto, a menos que se descubra un fraude o algún otro problema oculto importante después de que el artículo esté impreso, el artículo permanece en la literatura científica.

    Ahora somos testigos de un número creciente de excelentes artículos científicos, escritos por los mejores expertos en el campo, que se retiran de las principales revistas médicas y científicas semanas, meses e incluso años después de su publicación. Una revisión cuidadosa indica que en demasiados casos los autores se atrevieron a cuestionar el dogma aceptado por los controladores de las publicaciones científicas, especialmente en lo que respecta a la seguridad, los tratamientos alternativos o la eficacia de las vacunas.[ 12 , 63 ] Estas revistas dependen de la amplia publicidad de las compañías farmacéuticas para sus ingresos. Han ocurrido varios casos en los que poderosas compañías farmacéuticas ejercieron su influencia sobre los propietarios de estas revistas para eliminar artículos que de alguna manera cuestionan los productos de estas compañías.[ 13 , 34 , 35 ]

    Peor aún es el diseño real de artículos médicos para promocionar medicamentos y productos farmacéuticos que involucran estudios falsos, los llamados artículos escritos por fantasmas.[ 49 , 64 ] Richard Horton es citado por The Guardian diciendo que «las revistas se han convertido en operaciones de lavado de información para la industria farmacéutica». 13 , 63 ] Los artículos fraudulentos «escritos por fantasmas» patrocinados por gigantes farmacéuticos han aparecido regularmente en las principales revistas clínicas, como JAMA y New England Journal of Medicine, y nunca se eliminarán a pesar del abuso científico comprobado y la manipulación de datos.[ 49 , 63 ]

    Los artículos escritos por fantasma implican el uso de empresas de planificación cuyo trabajo es diseñar artículos que contengan datos manipulados para respaldar un producto farmacéutico y luego hacer que estos artículos sean aceptados por revistas clínicas de alto impacto, es decir, las revistas que tienen más probabilidades de afectar la toma de decisiones clínicas de los médicos. Además, proporcionan a los médicos en la práctica clínica reimpresiones gratuitas de estos artículos manipulados. The Guardian encontró 250 empresas dedicadas a este negocio de escritura fantasma. El paso final en el diseño de estos artículos para su publicación en las revistas más prestigiosas es reclutar expertos médicos reconocidos de instituciones prestigiosas, para agregar su nombre a estos artículos. 11 ]

    De vital importancia es la observación de los expertos en el campo de las publicaciones médicas de que no se ha hecho nada para detener este abuso. Los especialistas en ética médica han lamentado que debido a esta práctica generalizada “no se puede confiar en nada”. Si bien algunas revistas insisten en divulgar información, la mayoría de los médicos que leen estos artículos ignoran esta información o la excusan, y varias revistas dificultan la divulgación al requerir que el lector encuentre las declaraciones de divulgación en otro lugar. Muchas revistas no controlan tales declaraciones y las omisiones de los autores son comunes y sin castigo.

    En cuanto a la información puesta a disposición del público, prácticamente todos los medios de comunicación están bajo el control de estos gigantes farmacéuticos u otros que se están beneficiando de esta “pandemia”. Sus historias son todas iguales, tanto en contenido como en redacción. Los encubrimientos orquestados ocurren a diario y los datos masivos que exponen las mentiras generadas por estos controladores de información se ocultan al público. Todos los datos que llegan a los medios de comunicación nacionales (televisión, periódicos y revistas), así como las noticias locales que ve todos los días, provienen únicamente de fuentes «oficiales», la mayoría de las cuales son mentiras, distorsiones o se fabrican completamente de la nada. destinado a engañar al público.

    Los medios de televisión reciben la mayor parte de su presupuesto publicitario de las compañías farmacéuticas internacionales; esto crea una influencia irresistible para informar sobre todos los estudios inventados que respaldan sus vacunas y otros supuestos tratamientos.[ 14 ] Solo en 2020, las industrias farmacéuticas gastaron 6.560 millones de dólares en este tipo de publicidad.[ 13 , 14 ] La publicidad televisiva de Pharma ascendió a 4.580 millones, un increíble 75% de su presupuesto. Eso compra mucha influencia y control sobre los medios. Los expertos mundialmente famosos en todos los campos de las enfermedades infecciosas están excluidos de la exposición de los medios y de las redes sociales en caso de que se desvíen de alguna manera de las mentiras y distorsiones inventadas por los fabricantes de estas vacunas. Además, estas compañías farmacéuticas gastan decenas de millones en publicidad en las redes sociales, con Pfizer a la cabeza con $55 millones en 2020.[ 14 ]

    Si bien estos ataques a la libertad de expresión son lo suficientemente aterradores, aún peor es el control virtualmente universal que los administradores de hospitales han ejercido sobre los detalles de la atención médica en los hospitales. Estos mercenarios ahora están instruyendo a los médicos a qué protocolos de tratamiento se apegarán y qué tratamientos no usarán, sin importar cuán dañinos sean los tratamientos «aprobados» o cuán beneficiosos sean los tratamientos «no aprobados».[ 33 , 57 ]

    Nunca en la historia de la medicina estadounidense los administradores de hospitales han dictado a sus médicos cómo practicarán la medicina y qué medicamentos pueden usar. El CDC no tiene autoridad para dictar a hospitales o médicos sobre tratamientos médicos. Sin embargo, la mayoría de los médicos cumplieron sin la menor resistencia.

    La ley federal Care Act alentó este desastre humano al ofrecer a todos los hospitales de EE. UU. hasta 39.000 dólares por cada paciente de la UCI que pusieran respiradores, a pesar de que desde el principio era obvio que los respiradores eran una de las principales causas de muerte entre estos pacientes confiados y desprevenidos. . Además, los hospitales recibieron 12.000 dólares por cada paciente que ingresaba en la UCI, lo que explica, en mi opinión y en la de otros, por qué todas las burocracias médicas federales (CDC, FDA, NIAID, NIH, etc.) hicieron todo lo posible para prevenir la vida. – ahorro de tratamientos tempranos.[ 46 ] Dejar que los pacientes se deterioraran hasta el punto de necesitar hospitalización significó mucho dinero para todos los hospitales. Un número creciente de hospitales están en peligro de quiebra, y muchos han cerrado sus puertas, incluso antes de esta “pandemia”.[ 50 ] La mayoría de estos hospitales ahora son propiedad de corporaciones nacionales o internacionales, incluidos los hospitales universitarios.[ 10 ]

    También es interesante notar que con la llegada de esta «pandemia» hemos sido testigos de un aumento en las cadenas corporativas de hospitales que compran varios de estos hospitales financieramente en riesgo.[ 1 , 54 ] Se ha señalado que estos gigantes hospitalarios están utilizando miles de millones en ayuda federal para el covid-19 para adquirir estos hospitales en peligro financiero, lo que aumenta aún más el poder de la medicina corporativa sobre la independencia de los médicos. A los médicos expulsados ​​de sus hospitales les resulta difícil encontrar personal de otros hospitales para unirse, ya que también pueden ser propiedad del mismo gigante corporativo. Como resultado, las políticas obligatorias de vacunación incluyen un número mucho mayor de empleados de hospitales. Por ejemplo, Mayo Clinic despidió a 700 empleados por ejercer su derecho a rechazar una vacuna experimental peligrosa, esencialmente no probada.[ 51 , 57 ] Mayo Clinic hizo esto a pesar de que muchos de estos empleados trabajaron durante lo peor de la epidemia y están siendo despedidos cuando la variante Omicron es la cepa dominante del virus, tiene la patogenicidad de un resfriado común para la mayoría y las vacunas son ineficaces. en la prevención de la infección.

    Además, se ha comprobado que la persona asintomática vacunada tiene un título nasofaríngeo del virus tan alto como una persona infectada no vacunada. Si el propósito del mandato de vacunación es prevenir la propagación viral entre el personal del hospital y los pacientes, entonces son los vacunados quienes presentan el mayor riesgo de transmisión, no los no vacunados. La diferencia es que un enfermo no vacunado no iría a trabajar, el esparcidor vacunado asintomático sí lo hará.

    Lo que sí sabemos es que los principales centros médicos, como Mayo Clinic, reciben decenas de millones de dólares en subvenciones del NIH cada año, así como dinero de los fabricantes farmacéuticos de estas «vacunas» experimentales. En mi opinión, esa es la verdadera consideración que impulsa estas políticas. Si esto pudiera probarse en un tribunal de justicia, los administradores que hacen estos mandatos deberían ser procesados ​​con todo el peso de la ley y demandados por todas las partes perjudicadas.

    El problema de la bancarrota de los hospitales se ha vuelto cada vez más agudo debido a los mandatos de vacunación de los hospitales y, como resultado, una gran cantidad de personal de los hospitales, especialmente enfermeras, se niega a ser vacunado por la fuerza. 17 , 51 ] Todo esto no tiene precedentes en la historia de la atención médica. Los médicos dentro de los hospitales son responsables del tratamiento de sus pacientes individuales y trabajan directamente con estos pacientes y sus familias para iniciar estos tratamientos. Las organizaciones externas, como los CDC, no tienen autoridad para intervenir en estos tratamientos y hacerlo expone a los pacientes a graves errores por parte de una organización que nunca ha tratado a un solo paciente con COVID-19.

    Cuando comenzó esta pandemia, los CDC ordenaron a los hospitales que siguieran un protocolo de tratamiento que resultó en la muerte de cientos de miles de pacientes, la mayoría de los cuales se habrían recuperado si se hubieran permitido los tratamientos adecuados.[ 43 , 44 ] La mayoría de estas muertes podrían haberse evitado si se hubiera permitido a los médicos utilizar un tratamiento temprano con productos como la ivermectina, la hidroxicloroquina y una serie de otros medicamentos seguros y compuestos naturales. Se ha estimado, en base a los resultados de los médicos que tratan con éxito a la mayoría de los pacientes con covid, que de las 800,000 personas que se nos dice que murieron a causa de covid, 640,000 no solo podrían haberse salvado, sino que, en muchos casos, podrían haber regresado a su estado anterior. -El estado de salud de la infección había requerido un tratamiento temprano con estos métodos probados. Este descuido del tratamiento temprano constituye un asesinato en masa. Eso significa que en realidad habrían muerto 160.000, mucho menos que el número de muertes a manos de burocracias, asociaciones médicas y juntas médicas que se negaron a defender a sus pacientes. 43 , 44 ]

    Increíblemente, a estos médicos expertos se les impidió salvar a estas personas infectadas con Covid-19. Debería ser una vergüenza para la profesión médica que tantos médicos siguieran sin pensar los protocolos mortales establecidos por los controladores de la medicina.

    También hay que tener en cuenta que este evento nunca cumplió con los criterios de una pandemia. La Organización Mundial de la Salud cambió el criterio para hacer de esto una pandemia. Para calificar para un estado pandémico, el virus debe tener una alta tasa de mortalidad para la gran mayoría de las personas, lo que no ocurrió (con una tasa de supervivencia del 99,98 %), y no debe tener tratamientos existentes conocidos, que este virus tuvo, en hecho, un número creciente de tratamientos muy exitosos.

    Nunca se ha demostrado que las medidas draconianas establecidas para contener esta «pandemia» artificial tengan éxito, como enmascarar al público, encierros y distanciamiento social. Varios estudios cuidadosamente realizados durante temporadas anteriores de gripe demostraron que las mascarillas, de cualquier tipo, nunca habían impedido la propagación del virus entre el público.[ 60 ]

    De hecho, algunos estudios muy buenos sugirieron que las máscaras en realidad propagan el virus al dar a las personas una falsa sensación de seguridad y otros factores, como la observación de que las personas rompían constantemente la técnica estéril al tocar la máscara, al quitarse la máscara incorrectamente y al filtrar sustancias infecciosas. aerosoles alrededor de los bordes de la máscara. Además, las máscaras se desechaban en estacionamientos, senderos para caminar, se colocaban sobre mesas en restaurantes y se colocaban en bolsillos y carteras.

    A los pocos minutos de ponerse la máscara, se pueden cultivar varias bacterias patógenas de las máscaras, lo que pone a la persona inmunosuprimida en un alto riesgo de neumonía bacteriana y a los niños en un mayor riesgo de meningitis.[ dieciséis ] Un estudio realizado por investigadores de la Universidad de Florida cultivó más de 11 bacterias patógenas del interior de la máscara que usan los niños en las escuelas.[ 40 ]

    También se sabía que los niños esencialmente no corrían ningún riesgo de enfermarse por el virus o transmitirlo.

    Además, también se conoció que el uso de una máscara por más de 4 horas (como ocurre en todas las escuelas) produce una importante hipoxia (niveles bajos de oxígeno en sangre) e hipercapnia (niveles altos de CO2), que tienen una serie de efectos nocivos para la salud, incluyendo el deterioro del desarrollo del cerebro del niño.[ 4 , 72 , 52 ]

    Sabemos que el desarrollo del cerebro continúa mucho después de los años de la escuela primaria. Un estudio reciente encontró que los niños nacidos durante la «pandemia» tienen un coeficiente intelectual significativamente más bajo; sin embargo, las juntas escolares, los directores de escuelas y otros burócratas educativos obviamente no están preocupados.[ 18 ]

    HERRAMIENTAS DEL OFICIO DE ADOCTRINACIÓN
    Los diseñadores de esta pandemia anticiparon un retroceso por parte del público y que se harían grandes preguntas embarazosas. Para evitar esto, los controladores alimentaron a los medios con una serie de tácticas, una de las más utilizadas fue y es la estafa de «verificación de hechos». Con cada confrontación con evidencia cuidadosamente documentada, los «verificadores de hechos» de los medios respondieron con el cargo de «desinformación» y un cargo infundado de «teoría de la conspiración» que fue, en su léxico, «desacreditado». Nunca nos dijeron quiénes eran los verificadores de hechos o la fuente de su información de «desacreditación», solo teníamos que creer a los «verificadores de hechos». Un caso judicial reciente estableció bajo juramento que los «verificadores de hechos» de Facebook utilizaron la opinión de su propio personal y no expertos reales para verificar «hechos».[ 59 ] Cuando las fuentes se revelan, de hecho, son invariablemente los corruptos CDC, la OMS o Anthony Fauci o simplemente su opinión. Aquí hay una lista de cosas que fueron etiquetadas como «mitos» e «información errónea» que luego se demostró que eran ciertas.

    Los vacunados asintomáticos están propagando el virus de la misma manera que los infectados sintomáticos no vacunados.

    Las vacunas no pueden proteger adecuadamente contra nuevas variantes, como Delta y Omicron.

    La inmunidad natural es muy superior a la inmunidad de las vacunas y lo más probable es que dure toda la vida.

    La inmunidad de la vacuna no solo disminuye después de varios meses, sino que todas las células inmunitarias se ven afectadas durante períodos prolongados, lo que pone a las personas vacunadas en un alto riesgo de contraer todas las infecciones y el cáncer.

    Las vacunas COVID pueden causar una incidencia significativa de coágulos sanguíneos y otros efectos secundarios graves

    Los defensores de la vacuna exigirán numerosos refuerzos a medida que aparezca cada variante en escena.

    Fauci insistirá en la vacuna covid para niños pequeños e incluso bebés.

    Se requerirán pasaportes de vacunas para ingresar a un negocio, volar en un avión y usar el transporte público.

    Habrá campos de internamiento para los no vacunados (como en Australia, Austria y Canadá)

    A los no vacunados se les negará el empleo.

    Hay acuerdos secretos entre el gobierno, instituciones elitistas y fabricantes de vacunas.

    Muchos hospitales estaban vacíos o tenían poca ocupación durante la pandemia.

    La proteína de punta de la vacuna ingresa al núcleo de la célula, alterando la función de reparación del ADN celular.

    Cientos de miles han muerto por las vacunas y muchas veces más han resultado dañados permanentemente.

    El tratamiento temprano podría haber salvado la vida de la mayoría de los 700.000 que murieron.

    La miocarditis inducida por la vacuna (que se negó inicialmente) es un problema importante y desaparece en un período breve.

    Lotes mortales especiales (lotes) de estas vacunas se mezclan con la masa de otras vacunas contra el Covid-19

    Varias de estas afirmaciones de quienes se oponen a estas vacunas ahora aparecen en el sitio web de los CDC, la mayoría aún identificadas como «mitos». Hoy en día, una amplia evidencia ha confirmado que cada uno de estos llamados «mitos» eran de hecho ciertos. Muchos incluso son admitidos por el “santo de las vacunas”, Anthony Fauci. Por ejemplo, incluso nuestro presidente con discapacidad cognitiva nos dijo que una vez que se lanzara la vacuna, todas las personas vacunadas podrían quitarse las máscaras. ¡Ups! Nos dijeron poco después: los vacunados tienen altas concentraciones (títulos) del virus en la nariz y la boca (nasofaringe) y pueden transmitir el virus a otras personas con las que entran en contacto, especialmente a sus propios familiares. Continúen con las máscaras una vez más; de hecho, se recomienda el doble enmascaramiento. 27 , 42 , 45 ]

    Otra táctica de los defensores de la vacuna es demonizar a aquellos que rechazan vacunarse por una variedad de razones. Los medios de comunicación se refieren a estos individuos de pensamiento crítico como «antivacunas», «negadores de vacunas», «resistentes a las vacunas», «asesinos», «enemigos del bien común» y como los que prolongan la pandemia. Me han horrorizado los ataques viciosos, a menudo despiadados, de algunas personas en las redes sociales cuando un padre o un ser querido relata una historia del terrible sufrimiento y la eventual muerte que ellos o su ser querido sufrieron como resultado de las vacunas. Algunos psicópatas tuitean que están contentos de que el ser querido haya muerto o que la persona vacunada muerta fuera un enemigo del bien por contar el evento y debería prohibirse. Esto es difícil de conceptualizar. Este nivel de crueldad es aterrador y significa el colapso de una moral, decente,

    Ya es bastante malo que el público se hunda tan bajo, pero los medios de comunicación, los líderes políticos, los administradores de hospitales, las asociaciones médicas y las juntas de licencias médicas están actuando de una manera similar, moralmente disfuncional y cruel.

    LA LÓGICA, EL RAZONAMIENTO Y LA EVIDENCIA CIENTÍFICA HA DESAPARECIDO EN ESTE EVENTO
    ¿La evidencia científica, los estudios cuidadosamente realizados, la experiencia clínica y la lógica médica han tenido algún efecto para detener estas vacunas ineficaces y peligrosas? ¡Absolutamente no! Los esfuerzos draconianos para vacunar a todos en el planeta continúan (excepto la élite, los trabajadores postales, los miembros del Congreso y otros expertos).[ 31 , 62 ]

    En el caso de todos los demás medicamentos y vacunas convencionales anteriores que están siendo revisadas por la FDA, las muertes de 50 o menos personas que de otro modo no se explicarían darían lugar a la interrupción de la distribución del producto, como sucedió en 1976 con la vacuna contra la gripe porcina. Con más de 18 000 muertes reportadas por el sistema VAERS para el período del 14 de diciembre de 2020 y el 31 de diciembre de 2021 , así como 139 126 lesiones graves (incluidas las muertes) para el mismo período, todavía no hay interés en detener este programa de vacunación mortal.[ 61 ] Peor aún, no existe una investigación seria por parte de ninguna agencia gubernamental para determinar por qué estas personas mueren y resultan grave y permanentemente lesionadas por estas vacunas.[ 15 , 67 ] Lo que sí vemos es una serie continua de encubrimientos y evasivas por parte de los fabricantes de vacunas y sus promotores.

    La guerra contra los medicamentos reutilizados y los compuestos naturales, efectivos, baratos y muy seguros, que han demostrado sin lugar a dudas que han salvado millones de vidas en todo el mundo, no solo ha continuado sino que ha aumentado en intensidad.[ 32 , 34 , 43 ]

    Se les dice a los médicos que no pueden proporcionar estos compuestos que salvan vidas a sus pacientes y, si lo hacen, serán retirados del hospital, se les quitará la licencia médica o serán castigados de muchas otras maneras. Muchas farmacias se han negado a surtir recetas de lvermectina o hidroxicloroquina, a pesar de que millones de personas han tomado estos medicamentos de forma segura durante más de 60 años en el caso de la hidroxicloroquina y décadas en el caso de la ivermectina.[ 33 , 36 ] Esta negativa a surtir recetas no tiene precedentes y ha sido diseñada por aquellos que desean evitar métodos alternativos de tratamiento, todo basado en proteger la expansión de la vacuna para todos. Varias empresas que fabrican hidroxicloroquina acordaron vaciar sus existencias del medicamento donándolo a la Reserva Nacional Estratégica, lo que hace que este medicamento sea mucho más difícil de conseguir.[ 33 ] ¿Por qué el gobierno haría eso cuando más de 30 estudios bien hechos han demostrado que este medicamento redujo las muertes entre un 66 % y un 92 % en otros países, como India, Egipto, Argentina, Francia, Nigeria, España, Perú, México, ¿y otros?[ 23 ]

    Los críticos de estos dos medicamentos que salvan vidas suelen estar financiados por Bill Gates y Anthony Fauci, quienes están ganando millones con estas vacunas.[ 48 , 15 ]

    Para detener aún más el uso de estos medicamentos, la industria farmacéutica y Bill Gates/Anthony Fauci financiaron una investigación falsa para demostrar que la hidroxicloroquina era una droga peligrosa y podía dañar el corazón.[ 34 ] Para hacer este caso fraudulento, los investigadores administraron a los pacientes con covid más enfermos una dosis casi letal del medicamento, en una dosis mucho más alta que la utilizada en cualquier paciente con covid por el Dr. Kory, McCullough y otros médicos «reales» y compasivos. que en realidad estaban tratando a pacientes con covid.[ 23 ]

    Los medios de comunicación controlados y falderos, por supuesto, martillaron al público con historias sobre el efecto mortal de la hidroxicloroquina, todo con una mirada aterrorizada de falso pánico. Se demostró que todas estas historias sobre los peligros de la ivermectina no eran ciertas y algunas de ellas eran increíblemente absurdas.[ 37 , 43 ]

    El ataque a la ivermectina fue aún más cruel que el de la hidroxicloroquina. Todo esto, y mucho más, se relata meticulosamente en el excelente libro nuevo de Robert Kennedy, Jr: The Real Anthony Fauci. Bill Gates, las grandes farmacéuticas y la guerra global contra la democracia y la salud pública .[ 32 ] Si está realmente preocupado por la verdad y por todo lo que ha ocurrido desde que comenzó esta atrocidad, no solo debe leer, sino estudiar este libro cuidadosamente. Está completamente referenciado y cubre todos los temas con gran detalle. Esta es una tragedia humana de proporciones bíblicas diseñada por algunos de los psicópatas más viles y despiadados de la historia.

    Millones han sido asesinados y lisiados deliberadamente, no solo por este virus diseñado, sino por la vacuna misma y por las medidas draconianas utilizadas por estos gobiernos para “controlar la propagación de la pandemia”. No debemos ignorar las “muertes por desesperación” provocadas por estas medidas draconianas, que pueden superar los cientos de miles. Como resultado, millones han muerto de hambre en países del tercer mundo. Solo en los Estados Unidos, de las 800 000 personas que murieron, afirmadas por las burocracias médicas, más de 600 000 de estas muertes fueron el resultado de la negligencia deliberada del tratamiento temprano, bloqueando el uso de medicamentos reutilizados altamente efectivos y seguros, como el hidroxi- cloroquina e ivermectina, y el uso forzado de tratamientos letales como remdesivir y uso de ventiladores.

    Para agravar todo esto, debido a los mandatos de vacunación entre todo el personal del hospital, miles de enfermeras y otros trabajadores del hospital han renunciado o han sido despedidos.[ 17 , 30 , 51 ] Esto ha resultado en una escasez crítica de estos vitales trabajadores de la salud y reducciones peligrosas de camas de UCI en muchos hospitales. Además, como ocurrió en el Sistema de atención médica del condado de Lewis, un sistema de hospitales especializados en Lowville, Nueva York, cerró su unidad de maternidad luego de la renuncia de 30 empleados del hospital por las desastrosas órdenes obligatorias de vacunación del estado. La ironía en todos estos casos de renuncias es que los administradores aceptaron sin vacilar estas pérdidas masivas de personal a pesar de los desvaríos sobre sufrir escasez de personal durante una «crisis». Esto es especialmente desconcertante cuando nos enteramos de que las vacunas no previnieron la transmisión viral y que la variante predominante actual es de patogenicidad extremadamente baja.

    LOS PELIGROS DE LAS VACUNAS SON CADA VEZ MÁS REVELADOS POR LA CIENCIA
    Si bien la mayoría de los investigadores, virólogos, investigadores de enfermedades infecciosas y epidemiólogos han sido intimidados para guardar silencio, un número creciente de personas de alta integridad con una gran experiencia se han presentado para decir la verdad, es decir, que estas vacunas son mortales .

    La mayoría de las vacunas nuevas deben someterse a pruebas de seguridad exhaustivas durante años antes de ser aprobadas. Las nuevas tecnologías, como las vacunas de ARNm y ADN, requieren un mínimo de 10 años de pruebas cuidadosas y un seguimiento extenso. Estas nuevas supuestas vacunas fueron «probadas» durante solo 2 meses y luego los resultados de estas pruebas de seguridad se mantuvieron y continúan manteniéndose en secreto. El testimonio ante el Senador Ron Johnson de varios de los que participaron en el estudio de 2 meses indica que prácticamente nunca se realizó ningún seguimiento de los participantes del estudio previo al lanzamiento.[ 67 ] Las quejas sobre complicaciones fueron ignoradas y, a pesar de las promesas de Pfizer de que Pfizer pagaría todos los gastos médicos causados ​​por las «vacunas», estas personas afirmaron que no se pagó ninguno.[ 66 ] Algunos gastos médicos superan los 100.000 dólares.

    Como ejemplo del engaño de Pfizer y los demás fabricantes de vacunas de ARNm, está el caso de Maddie de Garay, de 12 años, que participó en el estudio de seguridad previo al lanzamiento de la vacuna de Pfizer. En la presentación de la Senadora Johnson con las familias de los heridos por la vacuna, su madre habló de las convulsiones recurrentes de su hija, que ahora está confinada a una silla de ruedas, debe ser alimentada por sonda y sufre daño cerebral permanente. En la evaluación de seguridad de Pfizer enviada a la FDA, su único efecto secundario aparece como un «dolor de estómago». Cada persona envió historias horribles similares.

    Los japoneses recurrieron a una demanda FOIA (Freedom of Information Act) para obligar a Pfizer a publicar su estudio secreto de biodistribución. La razón por la que Pfizer quería que se mantuviera en secreto es que demostraba que Pfizer mintió al público y a las agencias reguladoras sobre el destino del contenido de la vacuna inyectada (el portador de nanolípidos encerrado en el ARNm). Afirmaron que permaneció en el sitio de la inyección (el hombro), cuando en realidad su propio estudio encontró que se diseminó rápidamente por todo el cuerpo a través del torrente sanguíneo en 48 horas.

    El estudio también encontró que estos portadores de nanolípidos mortales se acumularon en concentraciones muy altas en varios órganos, incluidos los órganos reproductivos de hombres y mujeres, el corazón, el hígado, la médula ósea y el bazo (un órgano inmunológico importante). La concentración más alta estaba en los ovarios y la médula ósea. Estos portadores de nanolípidos también se depositaron en el cerebro.

    El Dr. Ryan Cole, un patólogo de Idaho, informó un aumento dramático en los cánceres altamente agresivos entre las personas vacunadas (no informado en los medios). Encontró una incidencia alarmantemente alta de cánceres altamente agresivos en individuos vacunados, especialmente melanomas altamente invasivos en jóvenes y cánceres uterinos en mujeres.[ 26 ] También están apareciendo otros informes de activación de cánceres previamente controlados entre pacientes de cáncer vacunados.[ 47 ] Hasta el momento, no se han realizado estudios para confirmar estos informes, pero es poco probable que tales estudios se realicen, al menos estudios financiados por subvenciones de los NIH.

    La alta concentración de proteínas espiga encontradas en los ovarios en el estudio de biodistribución podría muy bien afectar la fertilidad en mujeres jóvenes, alterar la menstruación y aumentar el riesgo de cáncer de ovario. La alta concentración en la médula ósea también podría poner a los vacunados en un alto riesgo de leucemia y linfoma. El riesgo de leucemia es muy preocupante ahora que han comenzado a vacunar a niños desde los 5 años de edad. Ninguno de estos fabricantes de vacunas contra el covid-19 ha realizado estudios a largo plazo, especialmente en lo que respecta al riesgo de inducción de cáncer. La inflamación crónica está íntimamente relacionada con la inducción, el crecimiento y la invasión del cáncer, y las vacunas estimulan la inflamación.

    A los pacientes con cáncer se les dice que deben vacunarse con estas vacunas mortales. Esto, en mi opinión, es una locura. Estudios más recientes han demostrado que este tipo de vacuna inserta la proteína espiga dentro del núcleo de las células inmunitarias (y muy probablemente de muchos tipos de células) y, una vez allí, inhibe dos enzimas de reparación de ADN muy importantes, BRCA1 y 53BP1, cuyo deber es reparar daño al ADN de la célula.[ 29 ] El daño del ADN no reparado juega un papel importante en el cáncer.

    Existe una enfermedad hereditaria llamada xeroderma pigmentoso en la que las enzimas reparadoras del ADN son defectuosas. Estas personas desafortunadas desarrollan múltiples cánceres de piel y, como resultado, una incidencia muy alta de cáncer de órganos. Aquí tenemos una vacuna que hace lo mismo, pero en un grado menos extenso.

    Una de las enzimas de reparación defectuosas causadas por estas vacunas se llama BRCA1, que se asocia con una incidencia significativamente mayor de cáncer de mama en mujeres y cáncer de próstata en hombres.

    Cabe señalar que nunca se realizaron estudios sobre varios aspectos críticos de este tipo de vacuna.

    Nunca han sido probados para efectos a largo plazo.

    Nunca se han probado para la inducción de autoinmunidad.

    Nunca se han probado adecuadamente para la seguridad durante cualquier etapa del embarazo.

    No se han realizado estudios de seguimiento en los bebés de mujeres vacunadas.

    No hay estudios a largo plazo sobre los hijos de mujeres embarazadas vacunadas después de su nacimiento (especialmente cuando se producen hitos del desarrollo neurológico).

    Nunca se ha probado para efectos en una larga lista de condiciones médicas:

    Diabetes

    Enfermedad del corazón

    aterosclerosis

    Enfermedades neurodegenerativas

    Efectos neuropsiquiátricos

    Inducción de trastornos del espectro autista y esquizofrenia

    Función inmune a largo plazo

    Transmisión vertical de defectos y trastornos

    Cáncer

    Trastornos autoinmunes

    La experiencia previa con las vacunas contra la gripe demuestra claramente que los estudios de seguridad realizados por investigadores y médicos clínicos vinculados a compañías farmacéuticas fueron esencialmente mal hechos o diseñados a propósito para mostrar falsamente la seguridad y encubrir los efectos secundarios y las complicaciones. Esto se demostró dramáticamente con los estudios falsos mencionados anteriormente diseñados para indicar que la hidroxicloroquina y la ivermectina eran ineficaces y demasiado peligrosas de usar.[ 34 , 36 , 37 ] Estos estudios falsos resultaron en millones de muertes y graves desastres de salud en todo el mundo. Como se indicó, el 80 % de todas las muertes fueron innecesarias y podrían haberse evitado con medicamentos reutilizados seguros y económicos con un historial de seguridad muy largo entre millones de personas que los han tomado durante décadas o incluso toda la vida.[ 43 , 44 ]

    Es más que irónico que quienes afirman que son responsables de proteger nuestra salud aprobaron un conjunto de vacunas mal probadas que ha resultado en más muertes en menos de un año de uso que todas las demás vacunas combinadas administradas en los últimos 30 años. Su excusa cuando se enfrentaron fue: «Tuvimos que pasar por alto algunas medidas de seguridad porque se trataba de una pandemia mortal».[ 28 , 46 ]

    En 1986, el presidente Reagan firmó la Ley Nacional de Lesiones por Vacunas Infantiles, que brindó protección general a los fabricantes farmacéuticos de vacunas contra litigios por lesiones por parte de familias de personas lesionadas por vacunas. La Corte Suprema, en una opinión de 57 páginas, falló a favor de las compañías de vacunas, lo que permitió efectivamente a los fabricantes de vacunas fabricar y distribuir vacunas peligrosas, a menudo ineficaces, a la población sin temor a las consecuencias legales. El tribunal insistió en un sistema de compensación por lesiones por vacunas que ha pagado solo una cantidad muy pequeña de recompensas a una gran cantidad de personas gravemente lesionadas. Se sabe que es muy difícil recibir estos premios. Según la Administración de Recursos y Servicios de Salud, desde 1988 el Programa de Compensación por Lesiones por Vacunas (VICP) ha acordado pagar 3,597 indemnizaciones entre 19, 098 personas lesionadas por la vacuna que solicitan una suma total de $ 3.8 mil millones. Esto fue antes de la introducción de las vacunas Covid-19, en las que las muertes por sí solas superan todas las muertes relacionadas con todas las vacunas combinadas durante un período de treinta años.

    En 2018, el presidente Trump promulgó la ley de «derecho a probar» que permitió el uso de medicamentos experimentales y todos los tratamientos no convencionales en casos de condiciones médicas extremas. Como hemos visto con la negativa de muchos hospitales e incluso la negativa general de los estados a permitir la ivermectina, la hidroxicloroquina o cualquier otro método «oficial» no aprobado para tratar incluso los casos terminales de Covid-19, estas personas infames han ignorado esta ley.

    CONTINUA EN EL SIGUIENTE POST ———————————————————-➤

    1. Zack Saetonious

      Extrañamente, no usaron la misma lógica o la ley cuando se trataba de la ivermectina y la hidroxicloroquina, las cuales se habían sometido a extensas pruebas de seguridad en más de 30 estudios clínicos de alta calidad y habían brindado excelentes informes sobre eficacia y seguridad en numerosos países. . Además, teníamos un registro de uso de hasta 60 años por millones de personas, usando estos medicamentos en todo el mundo, con un excelente historial de seguridad. Era obvio que un grupo de personas muy poderosas en conjunto con conglomerados farmacéuticos no querían que terminara la pandemia y querían las vacunas como única opción de tratamiento. El libro de Kennedy presenta este caso usando amplia evidencia y citas.[ 14 , 32 ]

      El Dr. James Thorpe, un experto en medicina materno-fetal, demuestra que estas vacunas covoid-19 administradas durante el embarazo han resultado en una incidencia de aborto espontáneo 50 veces mayor que la notificada con todas las demás vacunas combinadas.[ 28 ] Cuando examinamos su gráfico sobre malformaciones fetales, hubo una incidencia 144 veces mayor de malformaciones fetales con las vacunas Covid-19 administradas durante el embarazo en comparación con todas las demás vacunas combinadas. Sin embargo, la Academia Estadounidense de Obstetricia y Ginecología y el Colegio Estadounidense de Obstetricia y Ginecología respaldan la seguridad de estas vacunas para todas las etapas del embarazo y entre las mujeres que amamantan a sus bebés.

      Cabe señalar que estos grupos de especialidades médicas han recibido una importante financiación de la empresa farmacéutica Pfizer. El Colegio Estadounidense de Obstetricia y Ginecología, solo en el cuarto trimestre de 2010, recibió un total de $11,000 solo de la compañía farmacéutica Pfizer.[ 70 ] La financiación de las subvenciones del NIH es mucho mayor.[ 20 ] La mejor manera de perder estas subvenciones es criticar el origen de los fondos, sus productos o programas favoritos. Peter Duesberg, debido a que se atrevió a cuestionar la teoría favorita de Fauci sobre el SIDA causado por el virus del VIH, ya no recibió ninguna de las 30 solicitudes de subvención que presentó después de salir a bolsa. Antes de este episodio, como la autoridad líder en retrovirus en el mundo, nunca se le había negado una subvención del NIH.[ 39 ] Así funciona el sistema “corrupto”, a pesar de que gran parte del dinero de las subvenciones proviene de nuestros impuestos.

      LOTES CALIENTES: LOTES MORTAL DE LAS VACUNAS
      Ahora ha aparecido un nuevo estudio, cuyos resultados son aterradores.[ 25 ] Un investigador de la Universidad de Kingston en Londres realizó un análisis extenso de los datos de VAER (un subdepartamento de los CDC que recopila datos voluntarios sobre complicaciones de las vacunas), en el que agrupó las muertes informadas después de las vacunas según los números de lote de vacunas del fabricante. . Las vacunas se fabrican en lotes grandes llamados lotes. Lo que descubrió fue que las vacunas se dividen en más de 20 000 lotes y que uno de cada 200 de estos lotes (lotes) es demostrablemente mortal para cualquiera que reciba una vacuna de ese lote, que incluye millas de dosis de vacunas.

      Examinó todas las vacunas fabricadas: Pfizer, Moderna, Johnson y Johnson (Janssen), etc. Descubrió que entre cada 200 lotes de la vacuna de Pfizer y otros fabricantes, se encontró que un lote de los 200 era 50 veces más letal que las vacunas. lotes de otros lotes. Los otros lotes (lotes) de vacunas también estaban causando muertes y discapacidades, pero ni mucho menos en esta medida. Estos lotes mortales deberían haber aparecido al azar entre todas las «vacunas» si se tratara de un evento no intencional. Sin embargo, encontró que el 5% de las vacunas eran responsables del 90% de los eventos adversos graves, incluidas las muertes. La incidencia de muertes y complicaciones graves entre estos «lotes calientes» varió de más del 1000 % a varias millas por ciento más que los lotes comparables más seguros. Si cree que esto fue por accidente, piénselo de nuevo. Esta no es la primera vez que los «lotes calientes» son, en mi opinión, fabricadas a propósito y enviadas a todo el país, generalmente vacunas diseñadas para niños. En uno de esos escándalos, los “lotes calientes” de una vacuna terminaron en un solo estado y el daño se hizo evidente de inmediato. ¿Cuál fue la respuesta del fabricante? No fue para eliminar los lotes mortales de la vacuna. Ordenó a su compañía que esparciera los lotes calientes por todo el país para que las autoridades no vieran el efecto mortal obvio.

      Todos los lotes de una vacuna estan numerados; por ejemplo, Modera la etiqueta con códigos como 013M20A. Se demostró que los números de lote terminaron en 20A o 21A. Los lotes que terminaron en 20A fueron mucho más tóxicos que los que terminaron en 21A. Los lotes que terminaron en 20A tuvieron alrededor de 1700 eventos adversos, frente a unos pocos cientos a veinte o treinta eventos para los lotes 21A. Este ejemplo explica por qué algunas personas tuvieron pocos o ningún evento adverso después de recibir la vacuna, mientras que otras mueren o sufren daños graves y permanentes. Para ver la explicación del investigador, vaya a https://www.bitchute.com/video/6xIYPZBkydsu/ En mi opinión, estos ejemplos podrían sugerir una modificación intencional de la producción de la «vacuna» para incluir lotes mortales.

      He conocido y trabajado con varias personas preocupadas por la seguridad de las vacunas y puedo decirles que no son los malvados antivacunas que les dicen que son. Son personas de principios, morales y compasivas, muchas de las cuales son investigadores destacados y personas que han estudiado el tema de manera exhaustiva. Robert Kennedy, Jr, Barbara Lou Fisher, Dra. Meryl Nass, Profesor Christopher Shaw, Megan Redshaw, Dra. Sherri Tenpenny, Dr. Joseph Mercola, Neil Z. Miller, Dra. Lucija Tomjinovic, Dra. Stephanie Seneff, Dr. Steve Kirsch y el Dr. Peter McCullough solo por nombrar algunos. Estas personas no tienen nada que ganar y mucho que perder. Son atacados brutalmente por los medios de comunicación, las agencias gubernamentales y los multimillonarios de élite que creen que deberían controlar el mundo y todos los que lo habitan.

      ¿POR QUÉ FAUCI NO QUERÍA AUTOPSIAS DE LOS QUE MORÍAN DESPUÉS DE LA VACUNACIÓN?
      Hay muchas cosas sobre esta “pandemia” que no tienen precedentes en la historia médica. Uno de los más sorprendentes es que, en el punto álgido de la pandemia, se estaban realizando muy pocas autopsias, especialmente autopsias totales. Un virus misterioso se estaba propagando rápidamente por todo el mundo, un grupo seleccionado de personas con sistemas inmunológicos debilitados se estaba enfermando gravemente y muchos estaban muriendo y se desaconsejaba la única forma en que podíamos obtener rápidamente la mayor cantidad de conocimiento sobre este virus: una autopsia.

      Guerriero dijo que para finales de abril de 2020 habían muerto aproximadamente 150.000 personas, sin embargo, solo se habían realizado 16 autopsias y reportado en la literatura médica.[ 24 ] De estas, solo siete fueron autopsias completas, siendo las 9 restantes parciales o por biopsia con aguja o biopsia incisional. Recién después de 170.000 muertos por Covid-19 y cuatro meses de pandemia se hizo la primera serie de autopsias, es decir, más de diez. Y solo después de 280.000 muertes y un mes más, se realizó la primera gran serie de autopsias, unas 80 en total.[ 22 ] Sperhake, en un llamado para que las autopsias se realizaron sin cuestionamientos, dijo que la primera autopsia completa reportada en la literatura junto con microfotografías aparecieron en una revista médico-legal de China en febrero de 2020.[ 41 , 68 ] Sperhake expresó su confusión sobre por qué hubo renuencia a realizar autopsias durante la crisis, pero sabía que no provenía de los patólogos. La literatura médica estaba plagada de apelaciones de patólogos para que se realizaran más autopsias.[ 58 ] Sperhake dijo además que el Instituto Robert Koch (el sistema alemán de control de la salud) al menos inicialmente desaconsejó realizar autopsias. También sabía que en ese momento 200 instituciones de autopsias participantes en los Estados Unidos habían realizado al menos 225 autopsias en 14 estados.

      Algunos han afirmado que esta escasez de autopsias se basó en el temor del gobierno a la infección entre los patólogos, pero un estudio de 225 autopsias en casos de Covid-19 surgió solo un caso de infección entre el patólogo y se concluyó que fue una infección contraído. en otra parte.[ 19 ] Guerriero finaliza su artículo pidiendo más autopsias con esta observación: “Hombro con hombro, los patólogos clínicos y forenses superaron las obstrucciones de las víctimas de autopsia en las víctimas de los estudios de Covid-19 y generaron un conocimiento valioso sobre la fisiopatología de la interacción entre el SARS-CoV- 2 y el cuerpo humano, contribuyendo así a nuestra comprensión de la enfermedad.”[ 24 ]

      La sospecha sobre la renuencia mundial de las naciones a permitir estudios post mortem completos de las víctimas de Covid-19 puede basarse en la idea de que fue más que una casualidad. Hay al menos dos posibilidades que se destacan. Primero, aquellos que lideraron la progresión de este evento «no pandémico» en una «pandemia mortal» percibida en todo el mundo, estaban ocultando un secreto importante que las autopsias podrían documentar. Es decir, ¿cuántas de las muertes fueron causadas realmente por el virus? Para implementar medidas draconianas, como el uso obligatorio de máscaras, cierres, destrucción de negocios y, finalmente, la vacunación forzada obligatoria, necesarian un gran número de muertos resultantes de covid-19.El miedo seria la fuerza impulsora de todos estos programas destructivos de control de pandemias.

      Elder et al en su estudio de clasificación de los hallazgos de la autopsia en cuatro grupos.[ 22 ]

      Cierta muerte por Covid-19

      Probablemente muerte por covid-19

      Posible muerte por Covid-19

      No asociado con Covid-19, a pesar de la prueba positiva.

      Lo que posiblemente preocupó o incluso aterrorizó a los ingenieros de esta pandemia fue que las autopsias podrían mostrar, y lo hicieron, que algunas de estas llamadas muertes por covid-19 en realidad murieron a causa de sus enfermedades comórbidas. En la gran mayoría de los estudios de autopsia informados, los patólogos notaron múltiples condiciones comórbidas, la mayoría de las cuales en los extremos de la vida por sí solas podrían ser fatales. Anteriormente se sabía que los virus del resfriado común tenían un 8% de mortalidad en los asilos de ancianos.

      Además, se podría obtener evidencia valiosa de las autopsias que mejorarían los tratamientos clínicos y posiblemente podrían demostrar el efecto letal de los protocolos exigidos por los CDC que todos los hospitales deberían seguir, como el uso de respiradores y el fármaco letal remdesivir que destruye los riñones . . Las autopsias también demostraron la acumulación de errores médicos y una atención de mala calidad, ya que proteger a los médicos de las unidades de cuidados intensivos de los ojos de los familiares conduce inevitablemente a una atención de peor calidad, según lo informado por varias enfermeras que trabajan en estas areas.[ 53 – 55 ]

      A pesar de lo malo que fue todo esto, se está haciendo exactamente lo mismo en el caso de las muertes por la vacuna Covid: se han hecho muy pocas autopsias completas para entender por qué murieron estas personas, es decir, hasta hace poco. Dos investigadores altamente calificados, el Dr. Sucharit Bhakdi, un microbiólogo y experto altamente calificado en enfermedades infecciosas, y el Dr. Arne Burkhardt, un patólogo que es una autoridad ampliamente publicada que ha sido profesor de patología en varias instituciones prestigiosas, recientemente realizaron autopsias en 15 personas que tenían murió después de la vacunación. Lo que encontraron explica por qué tantos están muriendo y experimentando daños en los órganos y coágulos de sangre mortales.[ 5 ]

      Determinaron que 14 de las quince personas fallecieron a consecuencia de las vacunas y no por otras causas. El Dr. Burkhardt, el patólogo, demostró evidencia generalizada de un ataque inmunológico en los órganos y tejidos de las personas autopsiadas, especialmente en su corazón. Esta evidencia demostró una invasión extensa de pequeños vasos sanguíneos con cantidades masivas de linfocitos, que causan una destrucción celular extensa cuando se desencadenan. También se demostró que otros órganos, como los pulmones y el hígado, tenían daños extensos. Estas pruebas indican que las vacunas estaban causando que el cuerpo se atacara a sí mismo con consecuencias mortales.Uno puede ver fácilmente por qué Anthony Fauci, así como los funcionarios de salud pública y todos los que están promoviendo duramente estas vacunas, desalentaron públicamente las autopsias de los vacunados que luego fallecieron. También se puede ver que en el caso de las vacunas, que probablemente no se probaron antes de ser aprobados para el público en general, al menos las agencias reguladoras deberían haber estado obligadas a monitorear y analizar cuidadosamente todas las complicaciones graves, y seguramente las muertes , relacionados con estas vacunas. La mejor manera de hacerlo es con autopsias completas.

      Si bien aprendimos información importante de estas autopsias, lo que realmente se necesita son estudios especiales de los tejidos de aquellos que han muerto después de la vacunación para detectar la presencia de infiltración de proteína espiga en los órganos y tejidos. Esta sería información crítica, ya que dicha infiltración provocaría un daño severo a todos los tejidos y órganos involucrados, especialmente el corazón, el cerebro y el sistema impermeable. Los estudios en animales han demostrado esto. En estos individuos vacunados, la fuente de estas proteínas de punta serían los portadores de nanolípidos inyectados del ARNm que producen la proteína de punta.

      CONCLUSIONES
      Todos estamos viviendo uno de los cambios más drásticos en nuestra cultura, sistema económico y sistema político en la historia de nuestra nación y del resto del mundo. Nos han dicho que nunca volveremos a la “normalidad” y que se ha diseñado un gran reinicio para crear un “nuevo orden mundial”. Todo esto ha sido esbozado por Klaus Schwab, director del Foro Económico Mundial, en su libro sobre el “Gran Reinicio”.[ 66 ] Este libro brinda una gran cantidad de información sobre el pensamiento de los utópicos que se enorgullecen de reclamar esta «crisis» pandémica como su forma de marcar el comienzo de un mundo nuevo. Este nuevo orden mundial ha estado en los tableros de dibujo de los manipuladores de élite durante más de un siglo.[ 73 , 74 ] En este artículo me he concentrado en los efectos devastadores que esto ha tenido en el sistema de atención médica en los Estados Unidos, pero también incluye gran parte del mundo occidental. En artículos anteriores he discutido la lenta erosión de la atención médica tradicional en los Estados Unidos y cómo este sistema se ha vuelto cada vez más burocratizado y reglamentado.[ 7 , 8 ] Este proceso se estaba acelerando rápidamente, pero la aparición de esta, en mi opinión, «pandemia» fabricada ha transformado nuestro sistema de atención médica de la noche a la mañana.

      Como han visto, dentro de este sistema ha tenido lugar una serie de eventos sin precedentes. Los administradores de hospitales, por ejemplo, asumieron la posición de dictadores médicos, ordenando a los médicos que siguieran protocolos derivados no de quienes tienen una amplia experiencia en el tratamiento de este virus, sino de una burocracia médica que nunca ha tratado a un solo paciente con COVID-19. El uso obligatorio de respiradores en pacientes de la UCI con covid-19, por ejemplo, se impuso en todos los sistemas médicos y los médicos disidentes fueron rápidamente destituidos de sus puestos como cuidadores, a pesar de su demostración de métodos de tratamiento notablemente mejorados. Además, se les dijo a los médicos que usaran el medicamento remdesivir a pesar de su toxicidad comprobada, falta de efectividad y alta tasa de complicaciones. Se les dijo que usaran medicamentos que afectaran la respiración y enmascararan a todos los pacientes, a pesar de la dificultad para respirar del paciente. En cada caso, aquellos que se negaron a abusar de sus pacientes fueron retirados del hospital e incluso enfrentaron la pérdida de la licencia, o algo peor.

      Por primera vez en la historia médica moderna, el tratamiento médico temprano de estos pacientes fue ignorado en todo el país. Los estudios han demostrado que el tratamiento médico temprano salvó el 80% de un mayor número de estas personas infectadas cuando lo iniciaron médicos independientes.[ 43 , 44 ] El tratamiento temprano podría haber salvado más de 640.000 vidas en el transcurso de esta «pandemia». A pesar de la demostración del poder de estos primeros tratamientos, las fuerzas que controlaban la atención médica continuaron con esta política destructiva.

      A las familias no se les permitía ver a sus seres queridos, lo que obligaba a estas personas muy enfermas en los hospitales a enfrentarse a la muerte solas. Para colmo de males, los funerales se limitaron a unos pocos miembros de la familia en duelo, a quienes ni siquiera se les permitió sentarse juntos. Mientras tanto, a las grandes tiendas, como Walmart y Cosco, se les permitió operar con restricciones mínimas. A los pacientes de hogares de ancianos tampoco se les permitía recibir visitas familiares, y nuevamente se los obligaba a morir en soledad. Mientras tanto, en varios estados, siendo el más transparente en el estado de Nueva York, los ancianos infectados fueron trasladados deliberadamente de hospitales a hogares de ancianos, lo que resultó en tasas de mortalidad muy altas de estos residentes de hogares de ancianos. Al comienzo de esta «pandemia», más del 50% de todas las muertes ocurrían en hogares de ancianos.

      A lo largo de esta “pandemia”, los medios de comunicación, los funcionarios de salud pública, las burocracias médicas (CDC, FDA y OMS) y las asociaciones médicas nos han alimentado con una serie interminable de mentiras, distorsiones y desinformación. Los médicos, científicos y expertos en tratamientos infecciosos que formaron asociaciones diseñadas para desarrollar tratamientos más efectivos y seguros, fueron demonizados, acosados, avergonzados, humillados periódicamente y experimentaron la pérdida de la licencia, la pérdida de los privilegios del hospital y, en al menos un caso, posiblemente someterse a un examen psiquiátrico.[ 2 , sesenta y cinco , 71 ]

      A Anthony Fauci se le otorgó esencialmente el control absoluto de todas las formas de atención médica durante este evento, incluida la insistencia en que todos los médicos tratantes usaran los medicamentos de los que se benefició. Ordenó el uso de mascarillas, a pesar de que al principio se rió del uso de mascarillas para filtrar un virus. Gobernadores, alcaldes y muchas empresas siguieron sus órdenes sin dudarlo.

      Las medidas draconianas que se están utilizando, el enmascaramiento, los bloqueos, las pruebas de los no infectados, el uso de la prueba de PCR inexacta, el distanciamiento social y el rastreo de contactos habían demostrado ser de poca o ninguna utilidad durante pandemias anteriores, pero todos los intentos de rechazar estos métodos fueron en vano. Algunos estados ignoraron estas órdenes draconianas y tuvieron los mismos o menos casos, así como muertes, que los estados con las medidas más estrictas. Una vez más, ninguna cantidad de evidencia o demostración obvia en este sentido tuvo ningún efecto para poner fin a estas medidas socialmente destructivas. Incluso cuando países enteros, como Suecia, que evitó todas estas medidas, demostraron las mismas tasas de infecciones y hospitalizaciones que las naciones con las medidas más estrictas y draconianas, no se produjo ningún cambio de política por parte de las instituciones de control.

      Expertos en la psicología de eventos destructivos, como colapsos económicos, grandes desastres y pandemias anteriores, demostraron que las medidas draconianas tienen un costo enorme en forma de «muertes por desesperación» y en un aumento dramático de trastornos psicológicos graves. Los efectos de estas medidas pandémicas en el neurodesarrollo infantil son catastróficos y en gran medida irreversibles.

      Con el tiempo, decenas de miles podrían morir como resultado de este daño. Incluso cuando estas predicciones comenzaron a aparecer, los controladores de esta “pandemia” continuaron a toda máquina. Los drásticos aumentos de suicidios, el aumento de la obesidad, el aumento del consumo de drogas y alcohol, el empeoramiento de muchas medidas de salud y un aterrador aumento de los trastornos psiquiátricos, especialmente la depresión y la ansiedad, fueron ignorados por los funcionarios que controlaron este evento.

      Eventualmente nos enteramos de que muchas de las muertes fueron el resultado de negligencia médica. Las personas con afecciones médicas crónicas, diabetes, cáncer, enfermedades cardiovasculares y enfermedades neurológicas ya no recibían un seguimiento adecuado en sus clínicas y consultorios médicos. Las cirugías que no son de emergencia se suspendieron. Muchos de estos pacientes optaron por morir en casa antes que arriesgarse a ir a los hospitales y muchos consideraron los hospitales como “casas de la muerte”.

      Los registros de muertes han demostrado que hubo un aumento en las muertes entre las personas de 75 años o más, explicado principalmente por las infecciones por covid-19, pero para las personas de entre 65 y 74 años, las muertes habían aumentado mucho antes del inicio de la pandemia.[ 69 ] Entre las edades de 18 y 65 años, los registros demuestran un aumento impactante en las muertes no relacionadas con Covid-19. Algunas de estas muertes se explicaron por un aumento dramático en las muertes relacionadas con las drogas, unas 20,000 más que en 2019. Las muertes relacionadas con el alcohol también aumentaron sustancialmente y los homicidios aumentaron casi un 30% en el grupo de 18 a 65 años.

      El titular de la compañía de seguros OneAmerica afirmó que sus datos indicaban que la tasa de mortalidad de las personas de 18 a 64 años había aumentado un 40 % durante el período previo a la pandemia.[ 21 ] Scott Davidson, director ejecutivo de la compañía, afirmó que esto representó la tasa de mortalidad más alta en la historia de los registros de seguros, que realiza una amplia recopilación de datos sobre las tasas de mortalidad cada año. Davidson también señaló que este alto aumento de la tasa de mortalidad nunca se había visto en la historia de la recopilación de datos de muerte. Las catástrofes anteriores de magnitud monumental aumentaron las tasas de mortalidad en no más del 10 por ciento, el 40 por ciento no tiene precedentes.

      La Dra. Lindsay Weaver, directora médica de Indiana, afirmó que las hospitalizaciones en Indiana son más altas que en cualquier otro momento de los últimos cinco años. Esto es de vital importancia ya que se suponía que las vacunas reducirían significativamente las muertes, pero sucedió lo contrario. Los hospitales se están inundando con complicaciones de vacunas y personas en estado crítico debido a la negligencia médica causada por los cierres y otras medidas pandémicas.[ 46 , 56 ]

      Un número dramático de estas personas ahora está muriendo, y el aumento se produjo después de que se introdujeron las vacunas. Las mentiras que fluyen de aquellos que se han designado a sí mismos como dictadores médicos son infinitas. Primero, nos dijeron que el confinamiento duraría solo dos semanas, duraron más de un año. Luego nos dijeron que las máscaras no eran efectivas y que no era necesario usarlas. Rápidamente eso se invirtió. Luego nos dijeron que la máscara de tela era muy efectiva, ahora no lo es y todos deberían usar una máscara N95 y antes de eso deberían usar una máscara doble. Nos dijeron que había una grave escasez de respiradores, luego descubrimos que están sin usar en almacenes y basureros de la ciudad, todavía en sus cajas de embalaje. Se nos informó que los hospitales estaban llenos en su mayoría con personas no vacunadas y luego descubrimos que ocurría exactamente lo contrario en todo el mundo.

      Tras el lanzamiento de las vacunas, se les dijo a las mujeres que las vacunas eran seguras durante todos los estados del embarazo, solo para descubrir que no se habían realizado estudios sobre la seguridad durante el embarazo durante las «pruebas de seguridad» antes del lanzamiento de la vacuna. Nos dijeron que las pruebas cuidadosas en voluntarios antes de la aprobación de la EUA para uso público demostraron la seguridad extrema de las vacunas, solo para enterarnos de que estos desafortunados sujetos no fueron seguidos, las complicaciones médicas causadas por las vacunas no fueron pagadas y los medios cubrieron todo esto. .[ 67 ] También nos enteramos de que la FDA les dijo a los fabricantes farmacéuticos de las vacunas que no era necesario realizar más pruebas en animales (el público en general serían los conejillos de indias). Increíblemente, nos dijeron que las nuevas vacunas de ARNm de Pfizer habían sido aprobadas por la FDA. , que fue un gran engaño, en el sentido de que otra vacuna tenía aprobación (comirnaty) y no la que se estaba utilizando, la vacuna BioNTech. La vacuna aprobada por la comunidad no estaba disponible en los Estados Unidos. Los medios nacionales le dijeron al público que la vacuna de Pfizer había sido aprobada y ya no estaba clasificada como experimental, una mentira descarada. Estas mentiras mortales continúan. Es hora de detener esta locura y llevar a estas personas ante la justicia.

      Descargo de responsabilidad
      Los puntos de vista y las opiniones expresadas en este artículo son de los autores y no reflejan necesariamente la política o posición oficial de la Revista o su dirección.

      https://surgicalneurologyint-com.translate.goog/surgicalint-articles/covid-update-what-is-the-truth/?_x_tr_sl=auto&_x_tr_tl=es&_x_tr_hl=es-419&_x_tr_pto=wapp

      1. Maria Jesus

        CARAY ZACK, QUE DOSSIER TAN IMPRESIONANTE,
        GRACIAS ESTIMADO, BENDICIONES, TKM MARANATHA 🙏💙

    1. Zack Saetonious

      1 JUAN 5:14 BIBLIA DEL OSO 1569
      14 Y eſta es la confiança que tenemos en Dios, que ſi demandaremos alguna coſa conforme à ſu voluntad, el nos oye.

    2. Maria Jesus

      QUE CANCIÓN TAN BONITA Y PROFUNDA,
      GRACIAS ESTIMADO ZACK, BENDICIONES, TKM MARANATHA 🙏💙

  14. Al-Wali

    Artículo financiado por gigantes farmacéuticos recomienda gravar con impuestos a los no vacunados…
    .
    Datos de la Oficina Nacional de Estadísticas británica revelan que cerca de 70.000 personas murieron dentro de los 28 días después a la vacunación contra el Covid-19 en Inglaterra…
    .
    La vigilancia de Google infringe las normas de privacidad de la Unión Europea y alimenta el sistema de crédito social chino…
    .
    El agotamiento: la epidemia de la que nadie habla…
    .
    Lo puedes ver aquí: https://trikooba.blog/blog.html

      1. Al-Wali

        O quizá acaben “ellos” colgando de las cuerdas de la marioneta.

    1. Zack Saetonious

      44 craneos y 03 espigas maduras …. que quieren decir los nigromantes desde el Reino Unido?

      1. Zack Saetonious

        creo que se refiere a 3 continentes,…. una sumatoria de 44 millones de decesos …..pero no se que podria ser 12

  15. Maria Jesus

    ESTIMADO JOSÉ, NOS SUGIERES QUE TE DEMOS NUESTRA OPINIÓN SOBRE DOS PREGUNTAS,
    BIEN, A LA PRIMERA, LA PIEDRA DE MARMOL, PUES, NO SE QUE TE DIGA, ¿PARA QUE NARICES LA QUIERES?
    Y SOBRE LA PIEDRA FILOSOFAL, ¿LA HAS PROBADO? ¿HAS CONSEGUIDO CONVERTIR EL PLOMO EN ORO? PORQUE SI NO LO HAS CONSEGUIDO ¿PARA QUE NARICES LA QUIERES?
    BUENO SI QUERÍAS SINCERIDAD, ESA ES MI OPINIÓN,
    UN ABRAZO Y BENDICIONES, TKM, MARANATHA!! 🙏💙

    1. Maria Jesus

      P. D. JAJAJA. JAJAJA, NO TE ENFADES CONMIGO,
      🙏💙😂

  16. Al-Wali

    Vivo de una discapacidad y una ayuda complementaria. Hoy es la segunda vez que un trabajador borracho y drogadicto quería pelearse conmigo porque, según él y su padre (de apellido Manzano), soy un vago que vive de su dinero. Ellos no han visto mis crisis. No voy a desearles que padezcan ni una sola crisis de Síndrome de Ménière, porque no le deseo algo así ni al peor de mis enemigos. Pero ahora, por el estrés, estoy peor. Y ya llevo un tiempo bien fastidiado. Quizá debí llamar a la policía, ya que mi Señor me tiene amarrado sin poder pelear.

    1. Maria Jesus

      VAYA ESTIMADO, COMO SE SUELE DECIR PARECE QUE TE HA MIRADO UN TUERTO,
      PRIMERO TE QUERÍAN MATAR, Y AHORA QUERÍAN DARTE UNA PALIZA,
      VAS HA TENER QUE PEDIR PROTECCIÓN, AL ÚNICO DIOS VERDADERO ELOHIM YHWH, Y ÉL TE ENVIARÁ UN ÁNGEL PROTECTOR.
      BENDICIONES HERMANO, MARANATHA!! 🙏💙

      1. Al-Wali

        Sobre el tuerto…
        Quizá sí. El dajjal, el anticristo, es tuerto.

  17. Maria Jesus

    ESTIMADOS HERMAN@S DE ESE,
    QUIERO DECIROS QUE DESPUES DE ESCUCHAR A RICARDO DELGADO DE LA QUINTA COLUMNA, COMPRE EL LOTE QUE ÉL NOS RECOMENDÓ, PARA FORTALECER LAS DEFENSAS, Y LO HE TOMADO SABADO Y DOMINGO, MAÑANA, LO TOMARÉ MENOS LA VITAMINA D, Y DESPUÉS NO SÉ SI SEGUIR DIAS ALTERNOS O CADA DÍA (MENOS LA VIT. D, QUE EN LA FARMACIA ME RECOMENDARON, UNA AL MES).
    ¿LO ESTÁIS TOMANDO VOSOTROS?
    BENDICIONES, LKM, MARANATHA!! 🙏💙

    1. Al-Wali

      Yo expresé aquí mi opinión de que la quinta columna trabaja para “ellos”. Ojalá me equivoque.

        1. Al-Wali

          Quizá te dan una cuerda de la marioneta para que te olvides de las demás.

          1. Yosef Arad

            ME BASTA CON QUE SEA LA CUERDA VERDADERA SI LAS DEMAS SON FALSAS
            BENDICIONES

    2. Yosef Arad

      QUERIDA HERMANA M JESUS
      NO TE FIES DE LO QUE TE DIGAN EN LA FARMACIA
      DESGRACIADAMENTE YA NO SE PUEDE CONFIAR EN CASI NADIE
      NOSOTROSVTONAMOS EXACTAMENTE CESAS DOSIS QUE RECOMIENDA RICARDO DELGADO Y NOS HA IDO BASTANTE BIEN TODAH A YHWH
      LKM
      BENDICIONES

  18. ALEJANDRO

    PERMITANME HABLARLES A LOS QUE AUN NO CONOCEN A DIOS.
    AL UNICO Y VERDADERO QUE EXISTE Y ES.
    EL «YO SOY»
    MI BENDITO CREADOR QUE TANTO NOS AMA.

    EL SIEMPRE NOS DIJO QUE EL QUE LE BUSCA LO HAYA.

    EL QUE GOLPEA SU PUERTA LE ABRE Y CENARA CON EL.

    ¿BUSCASTE A AL DIOS VERDADERO, A TU CREADOR, AL QUE VERDADERAMENTE TE AMA PORQUE ERES SUYO?

    ¿ O SEGUISTE UNA RELIGION IMPUESTA POR LA FAMILIA, LA SOCIEDAD, EL MUNDO,
    O QUISISTE SABER LA VERDAD?

    EL QUE ME BUSCA ME HALLA, Y EL QUE GOLPEA A MI PUERTA LE ABRO Y CENA CONMIGO

    ¿QUIERES CENAR CON TU DIOS?

    EL UNICO Y VERDADERO

    SOLO TIENES QUE DESEAR CONOCERLO

    ¿ACASO NO QUIERES CONOCER EL AMOR DE TU VIDA?

    EL AMOR VERDADERO , EL AMOR QUE NO TE DEFRAUDA, EL AMOR QUE ES SUFRIDO, PORQUE NO LE DAMOS LA RETRIBUCION DE ESE AMOR, AMANDOLO COMO EL NOS AMA.

    QUIZAS NUNCA TE DIJERON QUE ESE DIOS QUE EXISTE Y ES DESDE SIEMPRE,

    SUFRE PORQUE TU , SU CREACION NO LE AMAS.

    ¿ERES TU UN AMOR NO CORRESPONDIDO, A TU DIOS CREADOR?

    ACASO CREES, QUE TU PUEDES SER ALGUIEN, Y QUE QUIERES HACER LO QUE QUIERAS, CUANDO NO PUEDES NI SIQUIERA NOMBRAR LAS ESTRELLAS NI SIQUIERA PUEDES CONOCES EL FINAL DEL UNIVERSO.

    NO PUEDES SABER NI LA CANTIDAD DE CABELLOS QUE PORTAS SOBRE TU CABEZA.
    NO PUEDES SABER CUANTOS KILOMETROS DE ARTERIAS EXISTEN EN TU CUERPO PARA LLEVAR A LO QUE DA VIDA A TU CUERPO QUE ES LA SANGRE.

    MENOS PUEDES SABER, QUE MAS ALLA DE TU CUERPO, EXISTE TU SER ETERNO, QUE NO DEPENDE DE SANGRE, NI DE ALIMENTOS, QUE NO SEA LA PALABRA DE DIOS, UNICO Y VERDADERO.

    OIMOS , PERO NO ENTENDEMOS, VEMOS, PERO NO DIVISAMOS LA VERDAD.

    POR TEMOR NOS RECLUIMOS EN RELIGIONES QUE NOS ATRAPAN, PARA SUS VILES CONVENIENCIAS, USANDO LA PALABRA DEL CREADOR, MODIFICANDOLOS A SU PIACHERE , A SU GUSTO, ANATEMA SON, MALDITOS, POR VIOLAR LO SAGRADO.

    OTROS CREEN QUE INVOCANDO A ANGELES, VAN A CONOCER LA VERDAD.

    PERO LA VERDAD ES UNICA COMO EL UNICO DIOS VERDADERO.

    LA VERDAD ES DIOS MISMO

    NO EXISTE OTRA VERDAD QUE LA QUE EL MISMO CREADOR TIENE

    SOLO PUEDO DECIRTE, QUE PORQUE AL UNICO DIOS CREADOR ASI LE PARECE.

    SU GRACIA, SU REGALO, DE PASAR POR EL TIEMPO O EL DIA MALO, Y SORTEARLO, POR SU BENDITA MISERICORDIA SE ACABA.

    BUSCALO DENTRO TUYO, AHI ESTA EL SOPLO DE VIDA QUE EL TE DIO.

    COMUNICATE CON ESE SOPLO, SU BENDITO ESPIRITU SANTO, Y TU ALMA LE PERTENECERA PARA SIEMPRE.

    Y TENDRAS VIDA ETERNA EN EL.

    VIDA ABUNDANTE, PORQUE ES EL QUE TIENE EL PODER DE CREAR TODAS LAS COSAS.

    EL TIEMPO SE ACABA, Y NO ES POR CREENCIA RELIGIOSA.

    SE ACABA PORQUE EL QUE LO CREO, DIO SU MEDIDA 120 JUBILEOS, 6 MIL AÑOS, NO MAS.

    MUY PRONTO A CUMPLIRSE

    SE QUE TE HAN ENGAÑADO , EN ELEGIR SI ERES DE TAL O CUAL RELIGION, QUE ENTONCES ERES DE LA VERDADERA.

    DIOS NO ES UNA RELIGION, ES UNA RELACION CON EL, LOS ANTIGUOS PATRIARCAS NO TENIAN RELIGION, TENIAN UNA RELACION CON DIOS.

    ¿QUIERES CONOCER LA VERDAD?
    SOLO HAY UNA

    LA PALABRA TE LO DICE NO SON LAS VERDADES, ES «»»LA VERDAD»»»

    SOLO TIENES QUE VIVIRLA, CREER QUE ES LA VERDAD, Y TUS OJOS (LOS QUE HOY ESTAN CERRADOS ) SE ABRIRAN.

    COMO EN UN ABRIR Y CERRAR DE OJOS, TU TRANSFORMACION, DE UN HUMANO MORTAL, SE CONVERTIRA EN UN SER ETERNO.

    POR LAS MARAVILLAS QUE HACE, EL QUE DISEÑO TODO, EL QUE HIZO TODO.

    Y QUE POR MAS INCOMPRENSIBLES QUE NOS PAREZCAN, SOLO NOS QUEDA DARLE TODA LA GLORIA, TODA LA HONRA Y TODO EL PODER, AQUEL QUE NO HAY NINGUNO COMO EL.

    BENDITO SEA SU NOMBRE POR TODA LA ETERNIDAD.
    AMEN

    ESE CAMINO, LA VERDAD Y LA VIDA ES JESUCRISTO.

    SON LAS PALABRAS DEL QUE SE HIZO CARNE PARA SALVARNOS DE LA TRAMPA ETERNA QUE NOS IMPUSO EL ENEMIGO CON SUS MENTIRAS.

    LO CREES O NO LO CREES ES TU DECISION DEL LIBRE ALBEDRIO.

    UNO TE LLEVA A LA VIDA ABUNDANTE, ETERNA.
    EL OTRO TE LLEVA A LA MUERTE ETERNA, DE SUFRIMIENTO Y ESCASEZ.

    SI TU ESPIRITU DE HUMANO, AUN NO LO ENTIENDE, SOLO DESEO QUE EN EL DIA MALO, ESTAS PALABRAS TE RESUENEN EN TU MENTE, PARA QUE NO ADORES AL FALSO CRISTO, AL FALSO MESIAS, Y NO TE PONGAS NINGUNA MARCA COMO GANADO QUE TE HAGA PERTENECIENTE A ALGUIEN, PORQUE NO ES TU CREADOR.

    TU CREADOR TE SELLA EN TU VERDADERO SER QUE ES ESPIRITUAL, NO TE SELLA NI EN LA MANO NI EN LA FRENTE.

    EL SELLO DEL VERDADERO DIOS, ESTA EN TODO TU SER, TU ERES EL MISMO SELLO DE DIOS, QUE HACE QUE NADIE TE PUEDA TOCAR

    PORQUE ERES PROPIEDAD DEL DIOS CREADOR.

    AMEN

  19. Zack Saetonious

    El Nuevo Orden Mundial se expone de nuevo: Michael Chertoff escribió la Ley Patriota. Ahora el villano del 911 es el jefe de DESINFORMACIÓN. Chertoff también es un Hunter Biden laptop truther…
    https://imgur.com/a/4bUnVUc

    1. Yosef Arad

      ASI ES ZACK
      EL 911 SIMBOLIZA LAS 2 COLUMNAS N@$ON1C@$ DEL TEMPLO DE SALOMON ,»BOAZ» Y J@KIN»._11) Y LA CRUZ EN FIRMA DE «X» QUE UNE SUS 4 EXTREMIS.
      PIR ESO FUE LA FIENA QUE DEJARON EN LOS AUTOATENTADOS DEL 11 S Y LA QUE SIGUEN DEJABDO EN EL NÚMERO DEL TELÉFONO DE URGENCIAS EN EEUU 911.
      LA BORR3GAD@ CONO DE COSTUMBRE NI SE ENTERA.
      https://duckduckgo.com/?q=columnas+del+Templi+de+Salomon&iax=images&ia=images&iai=https%3A%2F%2F2.bp.blogspot.com%2F-Duk5iRGzGKI%2FV2HHo_dEkCI%2FAAAAAAAAGqQ%2FkyGChXOnZB0CprOeUkWMDN5KEylP-PI6wCLcB%2Fs1600%2Fboaz_j10%252Bcopia.jpg
      BENDICIONES

  20. ALEJANDRO

    POR RARA COINCIDENCIA O MEJOR DICHO PORQUE EL ESPIRITU SANTO ASI LO QUISO.

    NO SUELO LEER LOS COMENTARIOS DE AQUI RADIOESE.

    PERO AL PUBLICAR EL MIO, ME APARECIO EN PRIMER LUGAR EL COMENTARIO DE MI QUERIDA HERMANA MA JESUS.

    LES VOY A CONTAR A TODOS MI SITUACION DE SALUD QUE EN PARTE LO SABE JOSE MI AMIGO DEL ALMA, Y QUE AUNQUE MUCHOS NO LE CREAN PORQUE SU HUMANIDAD, SU CUERPO ESTA EN EL, COMO TODOS NOSOTROS,Y QUE SOMOS INFLUENCIADOS POR EL PECADO, PERO SI DIOS LE ENCOMENDO HABLAR DE EL, INCLUSO CON LAS FALENCIAS QUE TODOS TENEMOS, BASTA CONOCER A MOISES QUE SEGUN LAS ESCRITURAS ERA LENTO EN HABLAR, MI OPINION QUE TODOS ESTOS AÑOS, DIOS LO HA USADO PARA LO QUE EL QUISO, TRAYENDO DEBATES, DISCUSIONES, PALABRAS COMUNES DE USO COTIDIANO ,Y SUMANDO Y RESTANDO GENTE, CON FE VERDADERA Y CON FE FALSA, LOS DE FE VERDADERA ALGUNOS ENTENDIENDO, UN LENGUAJE DISTINTO AL DE UNA RELIGION, CON EL FIN DE QUE QUIEN LO OIGA SE LE ACERQUE Y BUSQUE LA VERDAD.

    LA UNICA MANERA DE CONOCER AL DIOS VERDADERO NO ES A TRAVES DE UN RELIGIOSO , ES A TRAVES DE TU CORAZON EN BUSCA DE EL.

    MI CUERPO LE FALTA UNOS COLORES Y YA ES UN ARCO IRIS, MORADO, NEGRO, ROJO,ROSADO, EN FIN DE TODOS LOS COLORES, PORQUE LA SANGRE POR ALGUNOS LUGARES FLUYE BIEN Y POR OTROS NO.

    MI MENTE NI HABLAR, POR MOMENTOS BIEN POR OTROS TOTALMENTE LOCO Y ESTUPIDO.

    ME CUESTA RESPIRAR SI HAGO UNA PEQUEÑA FUERZA, O CAMINO APURADO.

    MI SEÑORA SE ENOJA PORQUE LO HAGO IGUAL.

    POR LA PROMESA

    TODO LO PUEDO EN CRISTO QUE ME FORTALECE.

    NO SOY YO, ES LA FE EN CRISTO QUE ME DA LA FUERZA PARA NO ESTAR TIRADO EN UNA CAMA.

    CUANDO LLEGUE EL MOMENTO DE DEJAR MI CUERPO, LO HARE DE PIE, ALABANDO A MI DIOS CREADOR DE TODO.

    EL PODER DE DIOS, ES TAN DESCONOCIBLE PARA NOSOTROS, PERO ES UNICO, TODO LO PUEDE, HASTA LO IMPOSIBLE PARA RAZONAMIENTO HUMANO.

    LES VOY A CONFESAR, QUE TENIENDO PROBLEMAS EN MIS PULMONES, NO ME HE VACUNADO NI PARA LA GRIPE NI PARA LA NEUMONIA.

    MENOS AUN LA VACUNA TRUCHA FALSA, QUE TE TENES QUE VACUNAR CADA RATO Y TE CONTAGIAS IGUAL.

    SIEMPRE DIGO SI ES MI MOMENTO DE PARTIR ES PORQUE ES LA VOLUNTAD DE DIOS, NO POR UNA VACUNA NI MEDICO GENIO.

    DIOS HA HECHO MILAGROS QUE LA CIENCIA NO SE EXLICA , COMO CURAS DE CANCER TOTAL. QUE LA CIENCIA NO ENTIENDE.

    POR ESO, HACE YA AÑOS ME HE PUESTO EN LAS MANOS DE MI SEÑOR

    PORQUE SOLO DE EL DEPENDE LO QUE VIVA, LO QUE ESCRIBA Y LO QUE PIENSE, PORQUE YA NO VIVO YO, MI VOLUNTAD HA DEJADO DE SER , DESDE EL MOMENTO QUE MI CUERPO DEJO DE ESTAR DOMINADO POR MI PROPIA MENTE.

    LO DOMINA DIOS DE ACUERDO A SU VOLUNTAD, DIGO EN LO QUE ORGANICAMENTE, SE REFIERE.

    HE TENIDO MOMENTOS QUE NO TUVE MI MEDICACION IMPRESCINDIBLE PARA VIVIR SEGUN LOS MEDICOS.

    ASI Y TODO AUN SIN MEDICAMENTOS, ME SOSTUVE EN PIE,
    POR MI ,CLARO QUE NO,
    ALGO SOBRENATURAL OPERA EN MI.

    Y SOLO LO SOBRENATURAL QUE ME DE LAS FUERZAS Y ME HAGA SEGUIR VIVIENDO,
    ES PRODUCTO DE AQUEL QUE DA LA VIDA.

    EL QUE TRAJO LA MUERTE, NADA PUEDE HACER SIN LA APROBACION DE MI CREADOR A QUIEN PERTENEZCO.

    PERO NO SOLO SOY YO

    MI SEÑORA, PORQUE ES OTRA LOCA COMO YO, ME SIGUE Y TAMPOCO HIZO NI HACE NADA POR TODAS LAS MANIFESTACIONES DEMONIACAS QUE NOS DICEN.

    AMBOS NI RESFRIOS TUVIMOS TODO ESTE TIEMPO , VIVIENDO EN PENSIONES CON MAS DE 35 PERSONAS Y CONTAGIADAS DE LA GRIPE MODIFICADA, QUE ESTOS INOCULARON.

    ME PREGUNTARAN, SI NO TOMO NADA PARA NO CONTAGIARME Y MI SEÑORA TAMPOCO, ¿QUE NOS MANTIENE BIEN?

    MI RESPUESTA , ASI DIOS LO QUIERE, MUCHOS TENDRAN LA FE QUE NOSOTROS TENEMOS.

    QUIZAS LA DIFERENCIA , ESTA QUE SI ES DE DIOS, LO ACEPTAMOS, SEA PARA BIEN O PARA MAL, PORQUE EN DEFINITIVA PARA NOSOTROS ES PARA BIEN.

    NO PIDO QUE SEAN TODOS TAN LOCOS COMO LO SOY YO.

    TOMO COMO PROMESA QUE DIOS ES MI REFUGIO, ES MI ROCA, ES MI FORTALEZA, POR LO TANTO, NADA PUEDE DOBLEGARME, NADA PUEDE ATACARME.

    COMO ALGUIEN DIJO QUE EL QUE ESTA EN UNA POSICION MAS ALTA EN EL TERRENO, TIENE MUCHAS MAS CHANCES DE OBTENER LA VICTORIA EN UNA GUERRA.

    TOMO LA PROMESA QUE MI DIOS ME UBICA EN LO MAS ALTO DE SU ROCA, Y NADIE SIQUIERA PUEDE LLEGAR A ELLA.

    ESE ES MI DIOS, QUE ME PROTEGE, ME DEFIENDE, PORQUE SOY SUYO, PORQUE SOY SU JOYA A QUIEN PULIO, PARA HACERLA HERMOSA PARA EL, PARA QUE AL MIRARME SIGA ENAMORADO DE MI , COMO CUANDO ME HIZO EN EL VIENTRE DE MI MADRE CON TODO SU AMOR..

    ESE ES MI DIOS, QUE VA A LUCHAR, PORQUE MI AMOR POR EL, NUNCA SE ACABE, VENGA QUIEN VENGA, MILLARES CONTRA MI, EL ME DEFENDERA, POR MI AMOR POR EL,

    DIO SU VIDA, A CAMBIO DE MI AMOR, UNA VEZ QUE SE LO OFRECI, ES UN DIOS CELOSO, NO QUIERE PERDERLO, Y EL MISMO LUCHARA, PARA QUE MI AMOR SIGA VIVO POR EL POR TODA LA ETERNIDAD.

    QUE MAS HACE FALTA

    SI DIOS CONMIGO QUIEN CONTRA MI.

    ¿LO CREES?

    TE ASEGURO, POR EXPERIENCIA PROPIA, NI LA MUERTE HA PODIDO CONMIGO, SI DIOS ESTA CONMIGO.

    AMEN

    QUE DIOS ME LOS BENDIGA.

    Y AQUEL QUE AUN ESTE EN LA OSCURIDAD, SUS OJOS SEAN ABIERTOS Y VEA LA HERMOSA LUZ QUE ES NUESTRO SALVADOR, LA LUZ DEL MUNDO.
    AMEN

    LKM

    TKMO COMO

    1. Maria Jesus

      ESTIMADO ALEJANDRO, NO HE PODIDO EVITAR LAS LÁGRIMAS DE EMOCIÓN, Y AFLIGIRME, CUANDO PIENSO EN EL GRAN AMOR DE NUESTRO PADRE HACÍA NOSOTROS, Y FIJATE EN LA HUMANIDAD QUE NO ES CONSCIENTE DE ELLO, LA GRAN MAYORÍA SOLO VIVE PARA SUS DELEITES Y NO CREE EN NADA MÁS.
      EN CIERTA OCASIÓN UNA AMIGA MUY QUERIDA, CUANDO LE HABLE DE DIOS, ME RESPONDIÓ, QUE NO CREÍA Y QUE NO ESPERABA NADA DESPUÉS, Y LE RESPONDÍ, VALE, PUES NADA TENDRÁS.
      PERO COMO LA QUIERO, A VECES LE DIGO QUE SIGO ORANDO POR ELLA, PARA QUE DONDE YO ESTÉ, ELLA TAMBIÉN ESTÉ.
      COMO SE HA DESCONECTADO EL SER HUMANO DE SU CREADOR, QUE TRISTEZA, Y QUE IMPOTENCIA SIENTO.
      MI QUERIDO ALEJANDRO, ADMIRO TU FORTALEZA (FUERZA QUE TE DA EL ESPÍRITU SANTO) Y SOBRE TODO TU GRAN FE EN NUESTRO «PADRE AMOROSO»
      Y LA GRAN ESPERANZA DE VIDA FUTURA QUE NOS TRANSMITES, CUANDO NOS HABLAS DE NUESTRO SEÑOR JESUCRISTO YESHUA
      DESDE LUEGO ERES UN MILAGRO, SUSTENTADO POR LA VOLUNTAD DE DIOS – ELOHIM, Y DOY GRACIAS POR HABERTE CONOCIDO, CON TU PRESENCIA EN RADIOESE, NOS APORTAS UNA GRAN FUERZA, Y UN GRAN AMOR FRATERNAL EN CRISTO. AMÉN Y AMÉN
      QUE NUESTRO SEÑOR TE BENDIGA Y TE CUIDE A TI Y TU FAMILIA,
      NUESTRO SEÑOR JESUCRISTO YESHUA ESTÁ VINIENDO YA!!! 🙏
      💙😂🎺🎶🎺🎵🎻🙏

    2. Yosef Arad

      QUERIDO HERMANO ALEJANDRO:
      !CUANTA BELLEZA EN TUS PALABRAS!
      TU SOLA SUPERVIVENCIA ES UNA PRUEBA IRREFUTABLE DE LA EXISTENCIA Y OMNIPOTENCIA DIVINAS.
      NOS DAS UNA LECCIÓN MAGISTRAL CADA VEZ QUE ESCRIBES EN RADIO ESE.
      ESPERO EN NUESTRO SEÑOR QUE TODOS LOS AQUI PRESENTES SEPAMOS APRECIAR EL INVALUABLE REGALO QUE ELOHIM NOS HACE DIA TRAS DIA CON TU PRESENCIA Y TUS PALABRAS QUE TRAS CIEN DEN LA SABIDURÍA HUMANA Y SE UBICAN EN UN PLANO SUPERIOR»EN UNA DIMENSIÓN QYE ESXAOA AK CONOCIMIENTO HUMANO Y SE INTERNA EN LAS INTRINCADAS LIANAS DE LO INTANGIBLE DE LO ETEREO DE LO CELESTIAL.
      EL ALTISINO TE PROFESA UN ANOR ILIMITADO,INCOMPRENSIBLE PARA NUESTROS LIMITADOS ENTENDIMIENTOS .
      UN FUERTE ABRAZO QUERIDO HERMANO DESDE LA ADMIRACIÓN Y EL AFECTO INCONDICIONAL ES QUE SIENTO,QUE SEBTIMOS GACIA TI.
      LKM
      BENDICIONES
      MARANATHA

  21. Zack Saetonious

    LA MALDAD EN SU ESTADO MAS PURO…… CON LA CAPACIDAD DE REDUCIR DRASTICAMENTE LA VIDA EN EL PLANETA
    —————————————————————————————————————————————————-
    Justia➢ patentes➢ Solicitud de patente de EE. UU. para POXVIRUS SINTÉTICOS QUIMÉRICOS Solicitud de patente (Solicitud n.º 20180251736)

    POXVIRUS QUIMÉRICOS SINTÉTICOS
    2 de noviembre de 2017
    La invención se refiere, en general, a poxvirus quiméricos sintéticos, composiciones que comprenden dichos virus, y al desarrollo y uso de sistemas y métodos para producir dichos poxvirus quiméricos sintéticos. Los poxvirus quiméricos sintéticos son muy adecuados para vacunas de virus vivos y formulaciones farmacéuticas.

    Saltar a: Descripción · Reclamaciones · Historial de patentes · Historial de patentes
    Descripción
    APLICACIONES RELACIONADAS
    Esta solicitud reivindica la prioridad y el beneficio de las solicitudes de patentes provisionales de EE. UU. 62/434,794, presentada el 15 de diciembre de 2016, y 62/416,577, presentada el 2 de noviembre de 2016. El contenido y las divulgaciones de cada una de estas solicitudes provisionales anteriores se incorporan aquí como referencia. en su totalidad.

    Se envía electrónicamente una lista de secuencias asociada con esta aplicación a través de EFS-Web en formato de texto, y por la presente se incorpora por referencia en su totalidad a la especificación. El nombre del archivo de texto que contiene el listado de secuencias es 104545-0026-101-SL.txt. El archivo de texto, creado el 25 de mayo de 2018, tiene un tamaño de 863 281 bytes.

    ANTECEDENTES DE LA INVENCIÓN
    Los poxvirus (miembros de la familia Poxviridae) son virus de ADN de doble cadena que pueden infectar tanto a humanos como a animales. Los poxvirus se dividen en dos subfamilias según el rango de huéspedes. La subfamilia Chordopoxviridae, que infecta a huéspedes vertebrados, consta de ocho géneros, de los cuales se sabe que cuatro géneros (Orthopoxvirus, Parapoxvirus, Molluscipoxvirus y Yatapoxvirus) infectan a los humanos. La viruela es causada por la infección con el virus de la viruela (VARV), un miembro del género Orthopoxvirus (OPV). El género OPV comprende una serie de virus genéticamente relacionados y morfológicamente idénticos, incluidos el virus de la viruela del camello (CMLV), el virus de la viruela bovina (CPXV), el virus de la ectromelia (ECTV, «agente de la viruela del ratón»), el virus de la viruela equina (HPXV), el virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela de la mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu, virus vaccinia (VACV), virus variólico (VARV) y virus volepox (VPV). Aparte del VARV, se sabe que al menos otras tres OPV, incluidas la VACV, la MPXV y la CPXV, infectan a los seres humanos. Hasta el momento, la vacunación con VVAC “vivos” es la única protección comprobada contra la viruela. Un agresivo programa de vacunación condujo a la erradicación de la viruela en 1980 y se detuvo la vacunación rutinaria contra la viruela del público. Sin embargo, sigue existiendo la necesidad de encontrar nuevos medios seguros y eficaces para vacunar a las personas contra el virus variólico viral y otras OPV.

    Se han utilizado una variedad de preparaciones de VACV como vacunas contra la viruela. La mayoría de estos se componen de una serie de virus relacionados (p. ej., Dryvax), y uno comprende un solo clon molecular, ACAM2000. Sin embargo, al igual que Dryvax y otras vacunas contra el VVAC, incluso ACAM2000 se asocia con efectos secundarios graves, como cardiomiopatía y pericarditis. Para reducir los riesgos, la vacuna ACAM2000, al igual que otras vacunas vivas, tiene numerosas contraindicaciones que excluyen a las personas con cáncer, inmunodeficiencias, receptores de trasplantes de órganos, pacientes con dermatitis atópica, eczema, psoriasis, afecciones cardíacas y pacientes con inmunosupresores. Se estima que entre el 15 y el 50 % de la población estadounidense entraría en una de estas categorías, lo que confirma la necesidad de desarrollar una vacuna o un protocolo de vacunación más seguro (Kennedy et al., 2007 Kennedy R, Poland G A. 2007. Descubrimiento del epítopo de células T para los virus variola y vaccinia. Rev Med Viroll7: 93-113). Por lo tanto, existe la necesidad de desarrollar una vacuna que sea equivalente en eficacia a Dryvax o ACAM2000™, pero que sea más segura.

    La presente invención proporciona poxvirus quiméricos ensamblados y replicados a partir de ADN sintetizado químicamente. Debido a que la síntesis del genoma químico no depende de una plantilla natural, es posible una gran cantidad de modificaciones estructurales y funcionales del genoma viral. La síntesis química del genoma es particularmente útil cuando no se dispone de una plantilla natural para la replicación o modificación genética mediante métodos convencionales de biología molecular.

    SUMARIO DE LA INVENCIÓN
    La presente invención proporciona poxvirus quiméricos sintéticos (p. ej., OPV quimérico sintético o scOPV), métodos para producir dichos virus y el uso de dichos virus, por ejemplo, como inmunógenos, en formulaciones inmunogénicas, en ensayos in vitro, como vehículos para la expresión génica heteróloga. , o como agentes oncolíticos. Los poxvirus quiméricos sintéticos de la invención se caracterizan por una o más modificaciones con respecto a un poxvirus de tipo salvaje.

    En parte, la presente invención se refiere al descubrimiento de que se puede producir un poxvirus quimérico sintético (p. ej., scOPV) a partir de fragmentos superpuestos sintetizados químicamente del genoma poxviral. En consecuencia, la presente invención, en parte, proporciona poxvirus quiméricos sintéticos (p. ej., scOPV) replicados y ensamblados a partir de ácidos nucleicos sintetizados químicamente. La divulgación también proporciona composiciones que comprenden dichos virus. La divulgación proporciona además métodos para usar los poxvirus producidos de acuerdo con los métodos de la divulgación.

    En otro aspecto, la invención proporciona un método para proteger humanos individuales y poblaciones de humanos contra las consecuencias de la infección con viruela, pseudotipos de virus de la viruela y otras OPV usando los poxvirus quiméricos sintéticos de la invención. En otro aspecto, la invención es un método para proteger humanos individuales y poblaciones de humanos contra las consecuencias de la infección por viruela (VARV) y pseudotipos de virus de la viruela mediante el uso de los poxvirus quiméricos sintéticos de la invención, con menos toxicidad, morbilidad y mortalidad que vacunas basadas en VACV disponibles. En ciertos aspectos, la invención proporciona un poxvirus quimérico sintético (scPV) que se replica y reactiva a partir de ADN derivado de ADN sintético,

    En algunas realizaciones, el ADN sintético se selecciona de uno o más de ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado y polinucleótidos que comprenden análogos de nucleósidos. En algunas realizaciones, el ADN sintético es ADN sintetizado químicamente.

    En algunas realizaciones, una o más modificaciones comprenden una o más deleciones, inserciones, sustituciones o una combinación de las mismas. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para introducir uno o más sitios de restricción únicos.

    En algunas realizaciones, el genoma viral comprende bucles en horquilla terminales heterólogos. En algunas realizaciones, el genoma viral comprende bucles en horquilla terminales derivados del virus vaccinia. En algunas realizaciones, los bucles en horquilla terminales izquierdo y derecho a) comprenden la forma lenta y la forma rápida del bucle en horquilla terminal del virus vaccinia, respectivamente, b) comprenden la forma rápida y la forma lenta del bucle en horquilla terminal del virus vaccinia, respectivamente , c) ambos comprenden la forma lenta del bucle terminal en horquilla del virus vaccinia, o d) ambos comprenden la forma rápida del bucle terminal del virus vaccinia.

    En algunas realizaciones, el virus se replica y reactiva a partir de fragmentos de ADN sintetizados químicamente superpuestos que corresponden sustancialmente a todo el genoma viral del scPV.

    En algunas realizaciones, el virus se replica y reactiva a partir de 1-14 fragmentos superpuestos. En algunas realizaciones, el virus se replica y reactiva a partir de 8-12 fragmentos superpuestos. En algunas realizaciones, el virus se replica y reactiva a partir de 10 fragmentos superpuestos.

    En algunas realizaciones, el virus se reactiva usando recombinación y reactivación catalizadas por el virus del leporipox. En algunas realizaciones, el virus del leporipox se selecciona del grupo que consiste en: virus del fibroma de Shope (SFV), virus del fibroma de liebre, virus del fibroma de conejo, virus del fibroma de ardilla y virus del mixoma.

    En ciertos aspectos, la invención proporciona un ortopoxvirus quimérico sintético (scOPV) que se replica y reactiva a partir de ADN derivado de ADN sintético, diferenciándose el genoma viral de dicho virus de un genoma de tipo salvaje de dicho virus en que se caracteriza por una o más modificaciones, derivándose las modificaciones de un grupo que comprende ADN sintetizado químicamente, ADNc o ADN genómico.

    En algunas realizaciones, el ADN sintético se selecciona de uno o más de: ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado y polinucleótidos que comprenden análogos de nucleósidos. En algunas realizaciones, el ADN sintético es ADN sintetizado químicamente.

    En algunas realizaciones, la OPV se selecciona del grupo que consiste en: virus de la viruela del camello (CMLV), virus de la viruela bovina (CPXV), virus de la ectromelia (ECTV), virus de la viruela equina (HPXV), virus de la viruela del mono (MPXV), virus vaccinia (VACV), virus de la viruela (VARV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu y virus volepox.

    En algunas realizaciones, la OPV es un VACV. En algunas realizaciones, el genoma viral se basa en el genoma de la cepa ACAM2000 del VVAC y difiere del genoma de ACAM2000 en que se caracteriza por una o más modificaciones. En algunas realizaciones, el genoma viral se basa en el genoma de la cepa IOC del VVAC y difiere del genoma IOC en que se caracteriza por una o más modificaciones. En algunas realizaciones, el genoma viral se basa en el genoma de la cepa MVA del VVAC y difiere del genoma de MVA en que se caracteriza por una o más modificaciones. En algunas realizaciones, el genoma viral se basa en el genoma de la cepa MVA-BN del VVAC y difiere del genoma de MVA-BN en que se caracteriza por una o más modificaciones. En algunas realizaciones, el genoma del VVAC de tipo salvaje es el genoma de una cepa seleccionada del grupo que consiste en:

    En algunas realizaciones, una o más modificaciones comprenden una o más deleciones, inserciones, sustituciones o una combinación de las mismas.

    En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para introducir uno o más sitios de restricción únicos. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar uno o más sitios de restricción. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar uno o más sitios de restricción AarI. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar todos los sitios de restricción de AarI. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar uno o más sitios de restricción BsaI.

    En algunas realizaciones, el genoma viral comprende bucles en horquilla terminales heterólogos. En algunas realizaciones, el genoma viral comprende bucles en horquilla terminales derivados del virus vaccinia. En algunas realizaciones, los bucles en horquilla terminales izquierdo y derecho a) comprenden la forma lenta y la forma rápida del bucle en horquilla terminal del virus vaccinia, respectivamente, b) comprenden la forma rápida y la forma lenta del bucle en horquilla terminal del virus vaccinia, respectivamente , c) ambos comprenden la forma lenta del bucle terminal en horquilla del virus vaccinia, o d) ambos comprenden la forma rápida del bucle terminal del virus vaccinia. En algunas realizaciones, la forma lenta comprende una secuencia de nucleótidos que es al menos un 85 % idéntica a la secuencia de nucleótidos de SEQ ID NO:

    En algunas realizaciones, el virus se replica y reactiva a partir de fragmentos de ADN sintetizados químicamente superpuestos que corresponden sustancialmente a todo el genoma viral de la OPV.

    En algunas realizaciones, el virus se replica y reactiva a partir de 1-14 fragmentos superpuestos. En algunas realizaciones, el virus se replica y reactiva a partir de 8-12 fragmentos superpuestos. En algunas realizaciones, el virus se replica y reactiva a partir de 10 fragmentos superpuestos.

    En algunas realizaciones, el virus se reactiva usando recombinación y reactivación catalizadas por el virus del leporipox. En algunas realizaciones, el virus del leporipox se selecciona del grupo que consiste en: virus del fibroma de Shope (SFV), virus del fibroma de liebre, virus del fibroma de conejo, virus del fibroma de ardilla y virus del mixoma.

    En ciertos aspectos, la invención proporciona un virus de la viruela quimérica sintético (scHPXV) que se replica y reactiva a partir de ADN sintético, diferenciándose el genoma viral de un genoma de tipo salvaje de HPXV en que se caracteriza por una o más modificaciones, derivándose las modificaciones de un grupo que comprende ADN sintetizado químicamente, ADNc o ADN genómico.

    En algunas realizaciones, el ADN sintético se selecciona de uno o más de: ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado y polinucleótidos que comprenden análogos de nucleósidos. En algunas realizaciones, el ADN sintético es ADN sintetizado químicamente.

    En algunas realizaciones, el genoma viral se basa en el genoma de la cepa MNR-76 de HPXV y difiere del genoma de MNR-76 en que se caracteriza por una o más modificaciones. En algunas realizaciones, una o más modificaciones comprenden una o más deleciones, inserciones, sustituciones o una combinación de las mismas.

    En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para introducir uno o más sitios de restricción únicos. En algunas realizaciones, una o más modificaciones están presentes en HPXV044 o HPXV095. En algunas realizaciones, una o más modificaciones comprenden una o más mutaciones enumeradas en la Tabla 3. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar uno o más sitios de restricción. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar uno o más sitios de restricción AarI. En algunas realizaciones, una o más modificaciones comprenden una o más modificaciones para eliminar todos los sitios de restricción de AarI. En algunas realizaciones, la una o más modificaciones comprenden una o más modificaciones para eliminar uno o más sitios de restricción BsaI.

    En algunas realizaciones, el genoma viral comprende bucles en horquilla terminales heterólogos. En algunas realizaciones, el genoma viral comprende bucles en horquilla terminales derivados del virus vaccinia. En algunas realizaciones, los bucles en horquilla terminales izquierdo y derecho a) comprenden la forma lenta y la forma rápida del bucle en horquilla terminal del virus vaccinia, respectivamente, b) comprenden la forma rápida y la forma lenta del bucle en horquilla terminal del virus vaccinia, respectivamente , c) ambos comprenden la forma lenta del bucle terminal en horquilla del virus vaccinia, o d) ambos comprenden la forma rápida del bucle terminal del virus vaccinia. En algunas realizaciones, la forma lenta comprende una secuencia de nucleótidos que es al menos un 85 % idéntica a la secuencia de SEQ ID NO: 11 y la forma rápida comprende una secuencia de nucleótidos que es al menos un 85 % idéntica a la secuencia de nucleótidos de SEQ ID NO : 12.

    En algunas realizaciones, el virus se replica y ensambla a partir de fragmentos de ADN sintetizados químicamente superpuestos que corresponden sustancialmente a todo el genoma viral de HPXV.

    En algunas realizaciones, el virus se replica y reactiva a partir de 1-14 fragmentos superpuestos. En algunas realizaciones, el virus se replica y reactiva a partir de 8-12 fragmentos superpuestos. En algunas realizaciones, el virus se replica y reactiva a partir de 10 fragmentos superpuestos.

    En algunas realizaciones, el virus se reactiva usando recombinación y reactivación catalizadas por el virus del leporipox. En algunas realizaciones, el virus del leporipox se selecciona del grupo que consiste en: virus del fibroma de Shope (SFV), virus del fibroma de liebre, virus del fibroma de conejo, virus del fibroma de ardilla y virus del mixoma.

    En ciertos aspectos, la invención proporciona un método para producir un poxvirus quimérico sintético (scPV) que comprende las etapas de: (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma viral del poxvirus; (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con virus auxiliares; (iii) cultivar dichas células para producir una mezcla de virus auxiliar y partículas poxvirales quiméricas sintéticas en dichas células; y (iv) sembrar la mezcla en células huésped específicas del scPV para recuperar el scPV.

    En algunas realizaciones, el virus auxiliar es un virus de leporipox. En algunas realizaciones, el virus del leporipox se selecciona del grupo que consiste en: virus del fibroma de Shope (SFV), virus del fibroma de liebre, virus del fibroma de conejo, virus del fibroma de ardilla y virus del mixoma. En algunas realizaciones, el virus del leporipox es SFV.

    En algunas realizaciones, el virus auxiliar es el virus de la viruela aviar.

    En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno.

    En algunas realizaciones, las células infectadas por el virus auxiliar son células BGMK.

    En algunas realizaciones, el paso (i) comprende además sintetizar químicamente bucles en horquilla terminales de un poxvirus y ligarlos a los fragmentos que comprenden los extremos izquierdo y derecho del genoma viral.

    En ciertos aspectos, la invención proporciona un método para producir un ortopoxvirus quimérico sintético (scOPV) que comprende los pasos de: (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma viral de la OPV; (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con virus auxiliares; (iii) cultivar dichas células para producir una mezcla de virus auxiliares y partículas de scOPV en dichas células; y (iv) sembrar la mezcla en células huésped específicas de OPV para recuperar la scOPV.

    En algunas realizaciones, el virus auxiliar es un virus de leporipox. En algunas realizaciones, el virus del leporipox se selecciona del grupo que consiste en: virus del fibroma de Shope (SFV), virus del fibroma de liebre, virus del fibroma de conejo, virus del fibroma de ardilla y virus del mixoma. En algunas realizaciones, el virus del leporipox es SFV.

    En algunas realizaciones, el virus auxiliar es el virus de la viruela aviar.

    En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno.

    En algunas realizaciones, las células infectadas por el virus auxiliar son células BGMK.

    En algunas realizaciones, las células huésped específicas de OPV son células BSC-40.

    En algunas realizaciones, la OPV se selecciona del grupo que consiste en: virus de la viruela del camello, virus de la viruela de las vacas, virus de la ectromelia, virus de la viruela del caballo, virus de la viruela del mono, virus vaccinia, virus de la viruela, virus de la viruela del conejo, virus de la viruela del mapache, virus de la viruela de la mofeta, virus de la viruela de Taterapox, enfermedad de Uasin Gishu virus, virus de la viruela viral.

    En algunas realizaciones, el paso (i) comprende además sintetizar químicamente bucles en horquilla terminales de una OPV y ligarlos a los fragmentos que comprenden los extremos izquierdo y derecho del genoma viral.

    En ciertos aspectos, la invención proporciona un método para producir un virus de la viruela equina quimérico sintético (scHPXV) que comprende los pasos de: (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma del HPXV; (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con virus auxiliares; (iii) cultivar dichas células para producir una mezcla de virus auxiliares y partículas de scHPXV en dichas células; y (iv) sembrar la mezcla en células huésped específicas de HPXV para recuperar el scHPXV.

    En ciertos aspectos, la invención proporciona un método para producir un virus de la viruela equina quimérico sintético (scHPXV) que comprende: (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma del HPXV; (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con el virus del fibroma de Shope (SFV); (iii) cultivar dichas células para producir una mezcla de partículas de SFV y scHPXV en dichas células; y (iv) sembrar la mezcla en células huésped específicas de HPXV para recuperar el scHPXV.

    En algunas realizaciones, el virus auxiliar es un virus de leporipox. En algunas realizaciones, el virus del leporipox se selecciona del grupo que consiste en: virus del fibroma de Shope (SFV), virus del fibroma de liebre, virus del fibroma de conejo, virus del fibroma de ardilla y virus del mixoma. En algunas realizaciones, el virus del leporipox es SFV.

    En algunas realizaciones, el virus auxiliar es el virus de la viruela aviar.

    En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno.

    En algunas realizaciones, las células infectadas por el virus auxiliar son células BGMK.

    En algunas realizaciones, las células huésped específicas de HPXV son células BSC-40.

    En algunas realizaciones, el paso (i) comprende además sintetizar químicamente los bucles en horquilla terminales de una OPV y ligarlos a los fragmentos que comprenden los extremos izquierdo y derecho del genoma de HPXV.

    En algunas realizaciones, los fragmentos de ADN superpuestos comprenden: i) secuencias de nucleótidos que son al menos un 85 % idénticas a las secuencias de SEQ ID NO: 1-10; ii) secuencias de nucleótidos que son al menos 90% idénticas a las secuencias de SEQ ID NO: 1-10; (iii) secuencias de nucleótidos que son al menos 95% idénticas a las secuencias de SEQ ID NO: 1-10; o (iv) secuencias de nucleótidos que consisten en las secuencias de SEQ ID NO: 1-10.

    En algunas realizaciones, las células infectadas con SFV son células BGMK.

    En algunas realizaciones, las células huésped específicas de HPXV son células BSC-40.

    En ciertos aspectos, la invención proporciona un poxvirus quimérico sintético (scPV) generado por los métodos de la divulgación.

    En ciertos aspectos, la invención proporciona un ortopoxvirus quimérico sintético (scOPV) generado por los métodos de la descripción.

    En ciertos aspectos, la invención proporciona un virus de la viruela equina quimérico sintético (scHPXV) generado por los métodos de la descripción.

    En ciertos aspectos, la invención proporciona composiciones que comprenden un vehículo farmacéuticamente aceptable y un scPV de la divulgación.

    En ciertos aspectos, la invención proporciona composiciones que comprenden un vehículo farmacéuticamente aceptable y una scOPV de la divulgación.

    En ciertos aspectos, la invención proporciona un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende una scOPV de la divulgación.

    En ciertos aspectos, la invención proporciona un método para desencadenar o potenciar una respuesta inmunitaria contra el virus vaccinia, que comprende administrar a un sujeto que lo necesite una composición que comprende una scOPV de la divulgación.

    En ciertos aspectos, la invención proporciona un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela símica, que comprende administrar a un sujeto que lo necesite una composición que comprende una scOPV de la divulgación.

    En ciertos aspectos, la invención proporciona un método para inmunizar a un sujeto humano para protegerlo de la infección por el virus de la viruela, que comprende administrar a dicho sujeto una composición que comprende una scOPV de la descripción.

    En ciertos aspectos, la invención proporciona un método para tratar una infección por el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende una scOPV de la divulgación.

    En ciertos aspectos, la invención proporciona una composición que comprende un vehículo farmacéuticamente aceptable y un scHPXV de la descripción.

    En ciertos aspectos, la invención proporciona un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende un scHPXV de la descripción.

    En ciertos aspectos, la invención proporciona un método para desencadenar o potenciar una respuesta inmunitaria contra el virus vaccinia, que comprende administrar a un sujeto que lo necesite una composición que comprende un scHPXV de la divulgación.

    En ciertos aspectos, la invención proporciona un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela símica, que comprende administrar a un sujeto que lo necesite una composición que comprende un scHPXV de la descripción.

    En ciertos aspectos, la invención proporciona un método para inmunizar a un sujeto humano para protegerlo de la infección por el virus de la viruela, que comprende administrar a dicho sujeto una composición que comprende un scHPXV de la divulgación.

    En ciertos aspectos, la invención proporciona un método para tratar una infección por el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende un scHPXV de la divulgación.

    En ciertos aspectos, la invención proporciona un kit que comprende una composición que comprende un scPV de la divulgación.

    En ciertos aspectos, la invención proporciona un kit que comprende una composición que comprende una OPV de la divulgación.

    En ciertos aspectos, la invención proporciona un kit que comprende una composición que comprende el scHPXV de la descripción.

    En ciertos aspectos, una composición de la invención se administra en una instalación de tratamiento de poxvirus. En ciertos aspectos, una instalación de tratamiento de poxvirus es una instalación en la que los sujetos que necesitan inmunización o tratamiento con una composición o método de la invención pueden inmunizarse o tratarse en un entorno tal que estén aislados de otros sujetos que no están destinados a ser inmunizados o tratados. o que podrían estar potencialmente infectados por el sujeto tratado (p. ej., cuidadores y miembros del hogar). En algunas realizaciones, los sujetos que no están destinados a ser inmunizados o potencialmente infectados por el sujeto tratado incluyen pacientes con VIH, pacientes que se someten a quimioterapia, pacientes que se someten a tratamiento para el cáncer, trastornos reumatológicos o trastornos autoinmunes, pacientes que se someten o han recibido un órgano o trasplante de tejido, pacientes con deficiencias inmunitarias, niños, mujeres embarazadas, pacientes con dermatitis atópica, eczema, psoriasis, afecciones cardíacas y pacientes con inmunosupresores, etc. En algunas realizaciones, la instalación de tratamiento de poxvirus es una instalación de tratamiento de ortopoxvirus. En algunas realizaciones, la instalación de tratamiento de poxvirus es una instalación de tratamiento de viruela.

    En ciertos aspectos, una composición de la invención es administrada por un especialista en eventos adversos de viruela. En algunas realizaciones, los eventos adversos de la viruela incluyen, pero no se limitan a, eczema vaccinatum, vaccinia progresiva, encefalitis posvacunal, miocarditis y miocardiopatía dilatada.

    BREVE DESCRIPCIÓN DE LOS DIBUJOS
    Esta solicitud de patente contiene al menos un dibujo ejecutado en color. La Oficina proporcionará copias de esta solicitud de patente con dibujos en color previa solicitud y pago de la tasa correspondiente.

    El resumen anterior, así como la siguiente descripción detallada de la invención, se entenderán mejor cuando se lean junto con los dibujos adjuntos. Con el propósito de ilustrar la invención, en los dibujos se muestran realizaciones que son actualmente preferidas. Debe entenderse, sin embargo, que la invención no se limita a las disposiciones e instrumentos precisos que se muestran.

    FIGURAS. 1A y 1B . Representación esquemática del genoma lineal dsDNA HPXV (cepa MNR; acceso a Genbank DQ792504). UNA. HIGO. 1A ilustra la secuencia genómica no modificada del genoma de HPXV con genes individuales de HPXV (púrpura) y los sitios AarI y BsaI naturales indicados. B. HIGO. 1B representa el genoma del HPXV quimérico sintético modificado (scHPXV) que se sintetizó químicamente usando los fragmentos de ADN genómico superpuestos (mostrado en rojo). También se muestran los sitios de restricción de SapI diseñados que se usaron para ligar los bucles en horquilla terminales de VACV en los ITR, junto con los sitios BsaI no modificados en los fragmentos de ITR izquierdo y derecho. Los sitios SapI se ubicaron en los sitios del vector del plásmido inmediatamente a los extremos izquierdo y derecho de la Repetición Terminal Invertida Izquierda (LITR) y la Repetición Terminal Invertida Derecha (RITR), respectivamente.

    HIGO. 2 (C.A). Representación esquemática detallada del genoma de scHPXV YFP-gpt::095 modificado y bucles de horquilla terminales de VVAC (cepa WR). UNA. HIGO. 2A representa el genoma modificado de scHPXV YFP-gpt::095. Los sitios BsaI no modificados se muestran como líneas azules en el genoma. Los nuevos sitios de restricción AvaI y StuI que se crearon en HPXV044 (el homólogo de VVAC F4L) también están marcados (líneas verdes). También se muestra (amarillo) la ubicación del marcador seleccionable proteína fluorescente amarilla/guanosina fosforribosil transferasa (yfp/gpt) en el locus HPXV095 (el homólogo de VACV J2R) de Frag_3. B. HIGO. 2B representa la secuencia de nucleótidos de las formas S (SEQ ID NO: 11) y F (SEQ ID NO: 12) del bucle en horquilla terminal, y la codificación por colores se explica en (C). C. HIGO. 2C representa las predicciones de la estructura secundaria de las formas F y S de los bucles de horquilla terminales que se unen covalentemente a los extremos terminales de los genomas de ADNbc lineal de VACV. La secuencia del bucle terminal está resaltada en verde. La secuencia de resolución del concatámero está enmarcada en rojo.

    FIGURAS. 3A y 3B . La horquilla terminal de VVAC de 70 pb se puede ligar a los fragmentos ITR de HPXV izquierdo y derecho. UNA. HIGO. 3A representa un diagrama esquemático de los fragmentos ITR de HPXV izquierdo y derecho que marcan las ubicaciones de los sitios de reconocimiento de SapI y PvuII. Se muestran los tamaños de fragmento previstos del ADN después de la digestión con SapI y PvuII. B. HIGO. 3B representa la electroforesis en gel de agarosa de los fragmentos de ITR izquierdo y derecho después de la ligadura de la horquilla terminal de ~70 pb al fragmento de ITR de 1472 pb cortado con SapI. Los ADN ligados se cortaron posteriormente con PvuII para facilitar la detección del pequeño cambio de tamaño provocado por la adición de las horquillas.

    FIGURAS. 4A-4C . El análisis de PCR y la digestión de restricción de los genomas de scHPXV YFP-gpt::095 confirman la reactivación exitosa de scHPXV YFP-gpt::095. UNA. HIGO. 4A representa los resultados del análisis PCR de clones scHPXV YFP-gpt::095. Los cebadores que flanquean los sitios de restricción BsaI conservados tanto en VACV como en scHPXV YFP-gpt::095 se usaron para amplificar una serie de productos de ~1 kpb. Los productos de la PCR se digirieron posteriormente con BsaI y los fragmentos de ADN resultantes se separaron mediante electroforesis en gel de agarosa. Se corta VACV, pero todos los sitios BsaI se han eliminado de dos clones scHPXV YFP-gpt::095 diferentes. B. HIGO. 4B representa la electroforesis en gel de campo pulsado (PFGE) de los ADN genómicos VACV-WR y scHPXV YFP-gpt::095. Los ADN del virus se digirieron con BsaI, HindIII o se dejaron sin tratar, y luego se separaron en un gel de agarosa dorada Seakem al 1 % durante 14 ha 14 °C a 5,7 V/cm con un tiempo de conmutación de 1 a 10 segundos. Se observó una ligera diferencia de tamaño entre los genomas intactos de VACV y scHPXV YFP-gpt::095. Las bandas tenues marcadas con un asterisco (*) son productos de digestión de ADN incompletos o podrían ser fragmentos de ADN mitocondrial cortados que a menudo contaminan las preparaciones de viriones de VACV. C. HIGO. 4C representa la electroforesis en gel de agarosa convencional de ADN genómico de VACV-WR y scHPXV YFP-gpt::095 digerido con BsaI o HindIII. Los fragmentos de ADN se visualizaron mediante la tinción de geles con tinción de ADN SybrGold.

    FIGURAS. 5A y 5B . Las horquillas terminales de VACV se ligaron con éxito en los fragmentos scHPXV YFP-gpt::095 ITR. A. Las lecturas de secuencias de Illumina se asignaron a la secuencia de referencia scHPXV YFP-gpt::095. El sitio SapI (en el vector, secuencia de cadena superior) se cortó para crear el punto para ligar las horquillas teloméricas en los fragmentos ITR izquierdo y derecho. Se muestra la ubicación del bucle terminal de la horquilla terminal derivada de VACV, junto con el sitio de resolución del concatámero. La primera A en el sitio de resolución del concatámero también es el primer nucleótido notificado para HBXV (NCBI DQ792504), el resto de la secuencia a la izquierda de esa «A» se diseñó usando VACV como referencia. Tenga en cuenta que las «C» simplemente se agregaron como un andamio para evitar el truncamiento de las lecturas por parte del programa ensamblador. B. Un subconjunto que comprende la secuenciación de Illumina más larga dice, que se extienden más allá de la secuencia conocida de HPXV, se muestran alineados contra una plantilla de polidC. Estas lecturas abarcan toda la longitud de una horquilla desplegada como se proporcionó originalmente utilizando oligonucleótidos sintéticos. Debido a las duplicaciones de terminales invertidos en los poxvirus, todas las lecturas de los extremos izquierdo y derecho se “apilan” y se pierde cualquier orientación o distribución original. Es evidente que se detectan las formas F y S de la horquilla del VACV y que la proporción de lecturas F y S en esta región fue de 1,03 ± 0,01 (SEM) en ocho reacciones diferentes de secuenciación de virus. todas las lecturas de los extremos izquierdo y derecho se “apilan” juntas y se pierde cualquier orientación o distribución original. Es evidente que se detectan las formas F y S de la horquilla del VACV y que la proporción de lecturas F y S en esta región fue de 1,03 ± 0,01 (SEM) en ocho reacciones diferentes de secuenciación de virus. todas las lecturas de los extremos izquierdo y derecho se “apilan” juntas y se pierde cualquier orientación o distribución original. Es evidente que se detectan las formas F y S de la horquilla del VACV y que la proporción de lecturas F y S en esta región fue de 1,03 ± 0,01 (SEM) en ocho reacciones diferentes de secuenciación de virus.

    FIGURAS. 6A-6C . Los sitios BsaI en la región 96.050 a 96.500 de scHPXV YFP-gpt::095 se mutaron correctamente. UNA. HIGO. 6A representa las lecturas de la secuencia de Illumina asignadas a una región del genoma de HPXV (DQ792504). Solo se muestra una pequeña fracción de las lecturas. Los conflictos en la secuencia se lee en la pos. 96.239 y pos. 96437 están resaltados en azul y amarillo, respectivamente. B. HIGO. 6B representa la ampliación de las lecturas de secuenciación de Illumina de scHPXV YFP-gpt::095 que se asignó a HPXV (DQ792504) cerca de la pos. 96239. Se detectó una sustitución de nucleótido (T96239C) (consulte la Tabla 2). C. HIGO. 6C representa la ampliación de las lecturas de secuenciación de Illumina de scHPXV YFP-gpt::095 que se asignó a HPXV (DQ792504) en la pos. 96437. Se detectó una sustitución de nucleótido (A96437C) (consulte la Tabla 2). Estas mutaciones se introdujeron en los clones utilizados para ensamblar scHPXV YFP-gpt::095 para eliminar los sitios de reconocimiento de BsaI no deseados (GGTCTC).

    FIGURAS. 7A-7C . Cambios de nucleótidos en el gen HPXV044 de scHPXV YFP-gpt::095 que se usaron para crear los sitios de restricción únicos AvaI y StuI. UNA. HIGO. 7A representa las lecturas de secuencia de Illumina asignadas al gen HPXV044 en el genoma de HPXV (DQ792504). Solo se muestra una pequeña fracción de las lecturas. HPXV044 codifica el homólogo HPXV de VACV F4L. Los sitios donde las lecturas de secuencia no coinciden con la secuencia original de HPXV (DQ792504) están resaltados en líneas verticales amarillas. B. HIGO. 7B representa la ampliación de las lecturas de secuenciación de Illumina de scHPXV YFP-gpt::095 que se asignó a HPXV (DQ792504) en la pos. 44,512. Se identificó una sustitución de nucleótidos (T44512G) que crea un sitio AvaI (CYCGRG; consulte la Tabla 2). C. HIGO. 7C representa la ampliación de las lecturas de secuenciación de Illumina de scHPXV YFP-gpt::095 que se asignó a HPXV (DQ792504) en la pos. 45,061. Se detectó una sustitución de nucleótidos (T45061G) que crea un sitio StuI (AGGCCT; consulte la Tabla 2).

    FIGURAS. 8A-8C . ScHPXV YFP-gpt::095 crece como otros Orthopoxvirus pero muestra un fenotipo de placa pequeña en las células BSC-40. UNA. HIGO. 8A ilustra el crecimiento de varios pasos de VACV-WR, DPP15, CPXV y scHPXV YFP-gpt::095 en BSC-40 (panel superior izquierdo), HeLa (panel superior central), HEL principal (panel superior derecho) y Vero (panel inferior izquierdo) líneas celulares. B. HIGO. 8B ilustra las comparaciones de tamaño de placa entre VACV-WR, DPP15, CPXV y scHPXV YFP-gpt::095. Las células BSC-40 se infectaron con los virus indicados y, 48 h después de la infección, las células se fijaron y tiñeron. Se midieron las áreas (en unidades arbitrarias [AU]) de 24 placas en tres experimentos independientes para cada virus. Los datos se expresan como el diámetro medio de la placa. **, P<0,01; ****, P25% de su peso inicial se sacrifican. Los puntos de datos representan puntuaciones medias y las barras de error representan la desviación estándar.

    FIGURAS. 11A y 11B . Representaciones gráficas del % de pérdida de peso a lo largo del tiempo después de la administración de diversas composiciones y dosis a ratones. Los datos representados se generan a partir de ratones que se vacunaron previamente ( HIGO. 10 ) y que luego son desafiados con una dosis letal de VACV WR (10 6 PFU) por vía intranasal. HIGO. 11A muestra los cambios de peso y HIGO. 11B muestra las puntuaciones clínicas en ratones registradas diariamente durante 13 días. Cualquier ratón que haya perdido > 25% de su peso inicial se sacrifica. A los ratones se les asigna una puntuación clínica basada en la apariencia de pelaje alborotado, postura encorvada, dificultad para respirar y disminución de la movilidad. Los puntos de datos representan diferencias medias en pesos o puntajes, y las barras de error representan la desviación estándar. † indica el número de ratones que sucumben a la infección por el virus de la vacuna vacuno-vacuna en un día determinado.

    HIGO. 12 . Representación gráfica del % de supervivencia a lo largo del tiempo tras la administración de diversas composiciones y dosis a ratones. Los datos representados se generan a partir de ratones que se vacunaron previamente ( HIGO. 10 ) y que luego son desafiados con una dosis letal de VACV WR (10 6 PFU) por vía intranasal. HIGO. 12 muestra las curvas de supervivencia de ratones que se exponen por vía intranasal a una dosis letal de VACV WR (10 6 PFU). † indique el número de ratones que sucumbieron a la infección por el virus VACV en el día indicado.

    FIGURAS. 13A y 13B . Caracterización de virus híbridos VACV-HPXV. A. Insertos de HPXV en la cepa WR de VACV. Los genomas de virus se secuenciaron utilizando una plataforma Illumina, se ensamblaron y LAGAN 32 y «Base-by-Base» 33Se utilizaron software para alinear y generar los mapas mostrados. Los lugares donde las secuencias de VACV (blanco) han sido reemplazadas por secuencias de HPXV están codificados por colores de acuerdo con la diferencia. El primer virus híbrido («VACV/HPXV+fragmento 3») se obtuvo mediante la cotransfección de ADN del virus VACV con HPXV Fragment_3 en células infectadas con SFV. La inserción etiquetada en verde codifica el marcador de selección YFP-gpt. Los clones 1-3 se obtuvieron purificando el ADN de este primer genoma híbrido y transfectándolo de nuevo, junto con los fragmentos 2, 4, 5 y 7 de HPXV, en células infectadas con SFV. B. Un enfoque de detección basado en PCR para identificar virus híbridos y reactivados. Cebadores de PCR diseñados para dirigirse tanto a HPXV como a VACV y utilizados para amplificar segmentos de ADN que abarcan los sitios BsaI que fueron mutados en los clones sintéticos de HPXV. Después de la amplificación por PCR, los productos se digirieron con BsaI para diferenciar las secuencias de VACV (que cortan) de HPXV (que no cortan). Los híbridos VACV/HPXV exhiben una combinación de sitios sensibles y resistentes a BsaI, mientras que el clon scHPXV YFP-gpt::095 reactivado es completamente resistente a BsaI.

    FIGURAS. 14A-14C . Propiedades de crecimiento de scHPXV frente a scHPXV YFP-gpt::095. A. Medidas del tamaño de la placa. Se usó recombinación homóloga para reemplazar el locus YFP-gpt en scHPXV YFP-gpt::095 con secuencias del gen de la timidina quinasa. Esto produjo un virus con un complemento completamente salvaje de genes HPXV (scHPXV). Se infectaron células BSC-40 con los virus indicados y se cultivaron durante tres días. Los platos se tiñeron y las áreas de placa se midieron usando una imagen digital escaneada. Se notan diferencias estadísticamente significativas ****P<0.0001). B. Imágenes de placa. C. Crecimiento de virus en varios pasos en cultivo. Las líneas celulares indicadas se infectaron con scHPXV o scHPXV YFP-gpt::095 a una multiplicidad de infección de 0,01, se recogió el virus en los tiempos indicados y se tituló en células BSC-40 por triplicado.

    DESCRIPCIÓN DETALLADA DE EL INVENTO
    Técnicas Generales
    A menos que se defina lo contrario en este documento, los términos científicos y técnicos utilizados en esta solicitud tendrán los significados que comúnmente entienden los expertos en la materia. En general, la nomenclatura utilizada en relación con la farmacología, el cultivo celular y tisular, la biología molecular, la biología celular y del cáncer, la neurobiología, la neuroquímica, la virología, la inmunología, la microbiología, la genética y la química de proteínas y ácidos nucleicos, y las técnicas de farmacología, cultivo de células y tejidos, descritas en este documento, son aquellas bien conocido y comúnmente utilizado en la técnica. En caso de conflicto, prevalecerá la presente especificación, incluidas las definiciones.

    La práctica de la presente invención empleará, a menos que se indique lo contrario, técnicas convencionales de biología molecular (incluidas las técnicas recombinantes), microbiología, biología celular, bioquímica e inmunología, que se encuentran dentro de los conocimientos de la técnica. Dichas técnicas se explican completamente en la literatura, como Molecular Cloning: A Laboratory Manual, segunda edición (Sambrook et al., 1989) Cold Spring Harbor Press; Síntesis de oligonucleótidos (MJ Gait, ed., 1984); Métodos en Biología Molecular, Humana Press; Biología celular: un cuaderno de laboratorio (JE Cellis, ed., 1998) Academic Press; Cultivo de células animales (RI Freshney, ed., 1987); Introducción al cultivo de células y tejidos (JP Mather y PE Roberts, 1998) Plenum Press; Cultivo de células y tejidos: procedimientos de laboratorio (A. Doyle, JB Griffiths y DG Newell, eds., 1993-1998) J. Wiley e Hijos; Métodos en Enzimología (Academic Press, Inc.); Vectores de transferencia de genes para células de mamíferos (JM Miller y MP Calos, eds., 1987); Protocolos Actuales en Biología Molecular (FM Ausubel et al., eds., 1987); PCR: La Reacción en Cadena de la Polimerasa, (Mullis et al., eds., 1994); Sambrook y Russell, Molecular Cloning: A Laboratory Manual, 3ro. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Nueva York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999). Vectores de transferencia de genes para células de mamíferos (JM Miller y MP Calos, eds., 1987); Protocolos Actuales en Biología Molecular (FM Ausubel et al., eds., 1987); PCR: La Reacción en Cadena de la Polimerasa, (Mullis et al., eds., 1994); Sambrook y Russell, Molecular Cloning: A Laboratory Manual, 3ro. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Nueva York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999). Vectores de transferencia de genes para células de mamíferos (JM Miller y MP Calos, eds., 1987); Protocolos Actuales en Biología Molecular (FM Ausubel et al., eds., 1987); PCR: La Reacción en Cadena de la Polimerasa, (Mullis et al., eds., 1994); Sambrook y Russell, Molecular Cloning: A Laboratory Manual, 3ro. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Nueva York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999). Ausubel et al., eds., 1987); PCR: La Reacción en Cadena de la Polimerasa, (Mullis et al., eds., 1994); Sambrook y Russell, Molecular Cloning: A Laboratory Manual, 3ro. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Nueva York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999). Ausubel et al., eds., 1987); PCR: La Reacción en Cadena de la Polimerasa, (Mullis et al., eds., 1994); Sambrook y Russell, Molecular Cloning: A Laboratory Manual, 3ro. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Nueva York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999). Protocolos Actuales en Biología Molecular, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999). Protocolos Actuales en Biología Molecular, John Wiley & Sons, NY (2002); Harlow y Lane usando anticuerpos: un manual de laboratorio, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Protocolos cortos en biología molecular (Wiley and Sons, 1999).

    CONTINUA EN EL SIGUIENTE POST ————————————————————————————➤

    1. Zack Saetonious

      Las reacciones enzimáticas y las técnicas de purificación se realizan de acuerdo con las especificaciones del fabricante, como se realiza comúnmente en la técnica o como se describe en el presente documento. Las nomenclaturas utilizadas en relación con, y los procedimientos y técnicas de laboratorio de química analítica, bioquímica, inmunología, biología molecular, química orgánica sintética y química farmacéutica y médica descritas en este documento son bien conocidas y comúnmente utilizadas en la técnica. Se utilizan técnicas estándar para síntesis químicas y análisis químicos.

      A lo largo de esta memoria descriptiva y realizaciones, se entenderá que la palabra «comprende», o variaciones tales como «comprende» o «que comprende», implican la inclusión de un número entero o grupo de números enteros, pero no la exclusión de cualquier otro número entero o grupo de números enteros. números enteros

      Se entiende que siempre que se describan realizaciones en el presente documento con el lenguaje «que comprende», también se proporcionan realizaciones análogas descritas en términos de «que consisten en» y/o «que consisten esencialmente en».

      El término «incluido» se utiliza para significar «incluido pero no limitado a». “Incluyendo” e “incluyendo pero no limitado a” se usan indistintamente.

      Cualquier ejemplo que siga al término «por ejemplo» o «por ejemplo» no pretende ser exhaustivo o limitante.

      A menos que el contexto requiera lo contrario, los términos singulares incluirán pluralidades y los términos plurales incluirán el singular.

      Los artículos “a”, “an” y “the” se utilizan aquí para referirse a uno o más de uno (es decir, al menos a uno) del objeto gramatical del artículo. A modo de ejemplo, “un elemento” significa un elemento o más de un elemento. La referencia a «sobre» un valor o parámetro aquí incluye (y describe) realizaciones que están dirigidas a ese valor o parámetro per se. Por ejemplo, la descripción que hace referencia a «sobre X» incluye la descripción de «X». Los rangos numéricos incluyen los números que definen el rango.

      A pesar de que los rangos numéricos y los parámetros que establecen el amplio alcance de la invención son aproximaciones, los valores numéricos establecidos en los ejemplos específicos se informan con la mayor precisión posible. Sin embargo, cualquier valor numérico contiene inherentemente ciertos errores que resultan necesariamente de la desviación estándar encontrada en sus respectivas mediciones de prueba. Además, debe entenderse que todos los rangos descritos en el presente documento abarcan todos y cada uno de los subintervalos incluidos en el mismo. Por ejemplo, se debe considerar que un rango establecido de «1 a 10» incluye todos y cada uno de los subrangos entre (e inclusive) el valor mínimo de 1 y el valor máximo de 10; es decir, todos los subintervalos que comienzan con un valor mínimo de 1 o más, por ejemplo, de 1 a 6,1, y terminan con un valor máximo de 10 o menos, por ejemplo, de 5,5 a 10.

      Cuando los aspectos o realizaciones de la invención se describen en términos de un grupo Markush u otra agrupación de alternativas, la presente invención abarca no solo el grupo completo enumerado como un todo, sino cada miembro del grupo individualmente y todos los posibles subgrupos del grupo principal. , y también el grupo principal en ausencia de uno o más de los miembros del grupo. La presente invención también contempla la exclusión explícita de uno o más de cualquiera de los miembros del grupo en la realización de la invención.

      En el presente documento se describen métodos y materiales ejemplares, aunque también se pueden usar métodos y materiales similares o equivalentes a los descritos en el presente documento en la práctica o ensayo de la presente invención. Los materiales, métodos y ejemplos son solo ilustrativos y no pretenden ser limitativos.

      Definiciones
      Los siguientes términos, a menos que se indique lo contrario, se entenderán con los siguientes significados:

      Como se usa en el presente documento, los términos «virus de tipo salvaje», «genoma de tipo salvaje», «proteína de tipo salvaje» o «ácido nucleico de tipo salvaje» se refieren a una secuencia de aminoácidos o ácidos nucleicos que se produce de forma natural en una determinada población (por ejemplo, una especie viral particular, etc.).

      Los términos «quimérico» o «diseñado» o «modificado» (p. ej., poxvirus quimérico, polipéptido diseñado, polipéptido modificado, ácido nucleico diseñado, ácido nucleico modificado) o variaciones gramaticales de los mismos se usan indistintamente en el presente documento para referirse a una secuencia no nativa que ha sido manipulado para tener uno o más cambios relativos a una secuencia nativa.

      Como se usa aquí, «virus sintético» se refiere a un virus derivado inicialmente de ADN sintético (por ejemplo, ADN sintetizado químicamente, ADN amplificado por PCR, ADN diseñado, polinucleótidos que comprenden análogos de nucleósidos, etc., o combinaciones de los mismos) e incluye su progenie y el la progenie puede no ser necesariamente completamente idéntica (en morfología o en complemento de ADN genómico) al virus sintético progenitor original debido a una mutación natural, accidental o deliberada. En algunas realizaciones, el virus sintético se refiere a un virus en el que sustancialmente todo el genoma viral se deriva inicialmente de ADN sintetizado químicamente.

      Como se describe en otra parte del presente documento, se pueden alterar ciertas posiciones del genoma viral. Por «posición», como se usa en el presente documento, se entiende una ubicación en la secuencia del genoma. Las posiciones correspondientes generalmente se determinan a través de la alineación con otras secuencias originales.

      Como se usa en el presente documento, «residuo» se refiere a una posición en una proteína y su identidad de aminoácidos asociada.

      Como se conoce en la técnica, «polinucleótido» o «ácido nucleico», como se usa de manera intercambiable en este documento, se refieren a cadenas de nucleótidos de cualquier longitud e incluyen ADN y ARN. Los nucleótidos pueden ser desoxirribonucleótidos, ribonucleótidos, bases o nucleótidos modificados y/o sus análogos, o cualquier sustrato que pueda ser incorporado en una cadena por la ADN o la ARN polimerasa. Un polinucleótido puede comprender nucleótidos modificados, como nucleótidos metilados y sus análogos. Si está presente, la modificación de la estructura de nucleótidos se puede impartir antes o después del ensamblaje de la cadena. La secuencia de nucleótidos puede ser interrumpida por componentes no nucleótidos. Un polinucleótido puede modificarse adicionalmente después de la polimerización, como por conjugación con un componente marcador. Otros tipos de modificaciones incluyen, por ejemplo, “caps”, sustitución de uno o más de los nucleótidos naturales con un análogo; modificaciones internucleotídicas tales como, por ejemplo, aquellas con enlaces no cargados (p. ej., fosfonatos de metilo, fosfotriésteres, fosfoamidatos, carbamatos, etc.) y con enlaces cargados (p. ej., fosforotioatos, fosforoditioatos, etc.); los que contienen restos colgantes, como, por ejemplo, proteínas (p. ej., nucleasas, toxinas, anticuerpos, péptidos señal, poli-L-lisina, etc.); aquellos con intercaladores (p. ej., acridina, psoraleno, etc.); los que contienen quelantes (p. ej., metales, metales radiactivos, boro, metales oxidativos, etc.); los que contienen alquiladores; aquellos con enlaces modificados (p. ej., ácidos nucleicos alfa anoméricos, etc.); así como formas no modificadas del(de los) polinucleótido(s). Más lejos, cualquiera de los grupos hidroxilo normalmente presentes en los azúcares puede reemplazarse, por ejemplo, por grupos fosfonato, grupos fosfato, protegerse con grupos protectores estándar o activarse para preparar enlaces adicionales a nucleótidos adicionales, o puede conjugarse con soportes sólidos. El OH terminal 5′ y 3′ puede fosforilarse o sustituirse con aminas o restos de grupos de protección orgánicos de 1 a 20 átomos de carbono. También se pueden derivatizar otros hidroxilos a grupos protectores estándar. Los polinucleótidos también pueden contener formas análogas de azúcares de ribosa o desoxirribosa que generalmente se conocen en la técnica, incluidos, por ejemplo, 2′-O-metil-, 2′-O-alilo, 2′-fluoro- o 2′-azido- ribosa, análogos de azúcares carbocíclicos, azúcares anoméricos alfa o beta, azúcares epímeros como arabinosa, xilosas o lixosas, azúcares de piranosa, azúcares de furanosa, sedoheptulosas, análogos acíclicos y análogos de nucleósidos abásicos tales como ribósido de metilo. Uno o más enlaces fosfodiéster pueden reemplazarse por grupos de enlace alternativos. Estos grupos de enlace alternativos incluyen, entre otros, realizaciones en las que el fosfato se reemplaza por P(O)S («tioato»), P(S)S («ditioato»), (O)NR2 (“amidato”), P(O)R, P(O)OR′, CO o CH 2 (“formacetal”), en los que cada R o R′ es independientemente H o alquilo sustituido o no sustituido (1-20 C ) que contiene opcionalmente un enlace éter (-O-), arilo, alquenilo, cicloalquilo, cicloalquenilo o araldilo. No todos los enlaces en un polinucleótido necesitan ser idénticos. La descripción anterior se aplica a todos los polinucleótidos a los que se hace referencia en el presente documento, incluidos el ARN y el ADN.

      Los términos «polipéptido», «oligopéptido», «péptido» y «proteína» se usan indistintamente aquí para referirse a cadenas de aminoácidos de cualquier longitud. La cadena puede ser lineal o ramificada, puede comprender aminoácidos modificados y/o puede estar interrumpida por no aminoácidos. Los términos también abarcan una cadena de aminoácidos que ha sido modificada de forma natural o por intervención; por ejemplo, formación de enlaces disulfuro, glicosilación, lipidación, acetilación, fosforilación o cualquier otra manipulación o modificación, como la conjugación con un componente marcador. También se incluyen dentro de la definición, por ejemplo, polipéptidos que contienen uno o más análogos de un aminoácido (incluidos, por ejemplo, aminoácidos no naturales, etc.), así como otras modificaciones conocidas en la técnica. Se entiende que los polipéptidos pueden presentarse como cadenas sencillas o cadenas asociadas.

      «Homólogo», en todas sus formas gramaticales y variaciones ortográficas, se refiere a la relación entre dos proteínas que poseen un «origen evolutivo común», incluidas proteínas de superfamilias en la misma especie de organismo, así como proteínas homólogas de diferentes especies de organismos. . Tales proteínas (y sus ácidos nucleicos codificantes) tienen homología de secuencia, como se refleja en su similitud de secuencia, ya sea en términos de porcentaje de identidad o por la presencia de residuos o motivos específicos y posiciones conservadas.

      Sin embargo, en el uso común y en la presente aplicación, el término «homólogo», cuando se modifica con un adverbio como «altamente», puede referirse a la similitud de secuencia y puede relacionarse o no con un origen evolutivo común.

      El término «similitud de secuencia», en todas sus formas gramaticales, se refiere al grado de identidad o correspondencia entre secuencias de ácidos nucleicos o aminoácidos que pueden o no compartir un origen evolutivo común.

      El «porcentaje (%) de identidad de secuencia» con respecto a una secuencia de polipéptido (o nucleótido) de referencia se define como el porcentaje de residuos de aminoácidos (o ácidos nucleicos) en una secuencia candidata que son idénticos a los residuos de aminoácidos (o ácidos nucleicos) en la secuencia polipeptídica (nucleótido) de referencia, después de alinear las secuencias e introducir huecos, si es necesario, para lograr el máximo porcentaje de identidad de secuencia, y sin considerar ninguna sustitución conservadora como parte de la identidad de secuencia. La alineación con el fin de determinar el porcentaje de identidad de la secuencia de aminoácidos se puede lograr de diversas formas que están dentro de la experiencia en la técnica, por ejemplo, usando software disponible públicamente como BLAST, BLAST-2, ALIGN o Megalign (DNASTAR). Los expertos en la materia pueden determinar los parámetros apropiados para alinear secuencias,

      Como se usa en el presente documento, una «célula huésped» incluye una célula individual o un cultivo celular que puede ser o ha sido un receptor de vectores para la incorporación de insertos de polinucleótidos. Las células huésped incluyen la progenie de una única célula huésped, y la progenie puede no ser necesariamente completamente idéntica (en morfología o en complemento de ADN genómico) a la célula original debido a una mutación natural, accidental o deliberada. Una célula huésped incluye células transfectadas y/o transformadas in vivo con un ácido nucleico de esta invención.

      Como se usa en el presente documento, «vector» significa una construcción que es capaz de administrar y, preferiblemente, expresar uno o más genes o secuencias de interés en una célula huésped. Los ejemplos de vectores incluyen, pero no se limitan a, vectores virales, vectores de expresión de ADN o ARN desnudos, vectores de plásmidos, cósmidos o fagos, vectores de expresión de ADN o ARN asociados con agentes de condensación catiónicos, vectores de expresión de ADN o ARN encapsulados en liposomas y ciertos células eucariotas, tales como células productoras.

      Como se usa en el presente documento, «secuencia de control de expresión» significa una secuencia de ácido nucleico que dirige la transcripción de un ácido nucleico. Una secuencia de control de la expresión puede ser un promotor, tal como un promotor constitutivo o inducible, o un potenciador. La secuencia de control de la expresión se une operativamente a la secuencia de ácido nucleico que se va a transcribir.

      Como se usa en este documento, «molécula aislada» (donde la molécula es, por ejemplo, un polipéptido, un polinucleótido o un fragmento del mismo) es una molécula que, en virtud de su origen o fuente de derivación (1), no está asociada con uno o más componentes naturalmente asociados que lo acompañan en su estado nativo, (2) está sustancialmente libre de una o más moléculas de la misma especie (3) es expresado por una célula de una especie diferente, o (4) no ocurre en la naturaleza. Así, una molécula que se sintetice químicamente, o se exprese en un sistema celular diferente de la célula de la que se origina naturalmente, estará “aislada” de sus componentes asociados naturalmente. Una molécula también puede quedar sustancialmente libre de componentes asociados de forma natural mediante aislamiento, utilizando técnicas de purificación bien conocidas en la técnica. La pureza u homogeneidad de las moléculas se puede ensayar mediante una serie de medios bien conocidos en la técnica. Por ejemplo, la pureza de una muestra de polipéptido puede ensayarse usando electroforesis en gel de poliacrilamida y tinción del gel para visualizar el polipéptido usando técnicas bien conocidas en la técnica. Para ciertos fines, se puede proporcionar una resolución más alta usando HPLC u otros medios bien conocidos en la técnica para la purificación.

      Como se usa en el presente documento, el término «aislado», en el contexto de virus, se refiere a un virus que se deriva de un único virus parental. Se puede aislar un virus usando métodos de rutina conocidos por los expertos en la técnica que incluyen, pero no se limitan a, aquellos basados ​​en purificación de placa y dilución limitante.

      Como se usa aquí, la frase «multiplicidad de infección» o «MOI» es el número medio de virus por célula infectada. La MOI se determina dividiendo el número de virus añadidos (ml añadidos × unidades formadoras de placas (PFU)) por el número de células añadidas (ml añadidos × células/ml).

      Como se usa en el presente documento, «purificar» y sus variaciones gramaticales se refiere a la eliminación, total o parcial, de al menos una impureza de una mezcla que contiene el polipéptido y una o más impurezas, lo que mejora el nivel de pureza del polipéptido. en la composición (es decir, disminuyendo la cantidad (ppm) de impureza(s) en la composición). Como se usa aquí, «purificado» en el contexto de los virus se refiere a un virus que está sustancialmente libre de material celular y medios de cultivo de la fuente celular o tisular de la que se deriva el virus. El lenguaje «sustancialmente libre de material celular» incluye preparaciones de virus en las que el virus se separa de los componentes celulares de las células de las que se aísla o se produce de forma recombinante. Por lo tanto, virus que está sustancialmente libre de material celular incluye preparaciones de proteína que tienen menos de aproximadamente 30 %, 20 %, 10 % o 5 % (en peso seco) de proteína celular (también denominada en el presente documento “proteína contaminante”). El virus también está sustancialmente libre de medio de cultivo, es decir, el medio de cultivo representa menos del 20%, 10% o 5% del volumen de la preparación de virus. Un virus se puede purificar usando métodos de rutina conocidos por los expertos en la técnica que incluyen, pero no se limitan a, cromatografía y centrifugación.

      Como se usa en el presente documento, «sustancialmente puro» se refiere a material que es al menos 50 % puro (es decir, libre de contaminantes), más preferiblemente, al menos 90 % puro, más preferiblemente, al menos 95 % puro, aún más preferiblemente, al menos 98% puro, y lo más preferiblemente, al menos 99% puro.

      Los términos «paciente», «sujeto» o «individuo» se usan indistintamente en este documento y se refieren a un ser humano o a un animal no humano. Estos términos incluyen mamíferos, como humanos, primates, ganado (incluidos bovinos, porcinos, camellos, etc.), animales de compañía (p. ej., caninos, felinos, etc.) y roedores (p. ej., ratones y ratas).

      Como se usa en el presente documento, los términos «prevenir», «prevenir» y «prevención» se refieren a la prevención de la recurrencia o aparición de, o una reducción de uno o más síntomas de una enfermedad (por ejemplo, una infección poxviral) en un sujeto como como resultado de la administración de una terapia (p. ej., un agente profiláctico o terapéutico). Por ejemplo, en el contexto de la administración de una terapia a un sujeto para una infección, «prevenir», «prevenir» y «prevención» se refieren a la inhibición o reducción en el desarrollo o aparición de una infección (p. ej., una infección poxviral). infección o una afección asociada con la misma), o la prevención de la recurrencia, aparición o desarrollo de uno o más síntomas de una infección (p. ej., una infección poxviral o una afección asociada con la misma), en un sujeto como resultado de la administración de una terapia (p.ej,

      “Tratar” una condición o paciente se refiere a tomar medidas para obtener resultados beneficiosos o deseados, incluidos los resultados clínicos. Con respecto a las infecciones (p. ej., una infección poxviral), el tratamiento se refiere a la erradicación o el control de la replicación de un agente infeccioso (p. ej., un poxvirus), la reducción del número de un agente infeccioso (p. ej., la reducción del título de poxvirus), la reducción o mejora de la progresión, gravedad y/o duración de una infección (p. ej., una infección por poxvirus o una afección o síntomas asociados con la misma), o la mejora de uno o más síntomas que resultan de la administración de uno o más terapias (incluyendo, pero sin limitarse a, la administración de uno o más agentes profilácticos o terapéuticos). Con respecto al cáncer, el tratamiento se refiere a la erradicación, remoción, modificación, o control de tejido canceroso primario, regional o metastásico que resulta de la administración de uno o más agentes terapéuticos de la invención. En ciertas realizaciones, tales términos se refieren a minimizar o retrasar la propagación del cáncer resultante de la administración de uno o más agentes terapéuticos de la invención a un sujeto con dicha enfermedad. En otras realizaciones, dichos términos se refieren a la eliminación de células causantes de enfermedades.

      La «administración» o la «administración de» una sustancia, un compuesto o un agente a un sujeto puede llevarse a cabo usando uno de una variedad de métodos conocidos por los expertos en la técnica. Por ejemplo, un compuesto o un agente puede administrarse por vía sublingual o intranasal, por inhalación en el pulmón o por vía rectal. La administración también se puede realizar, por ejemplo, una vez, una pluralidad de veces y/o durante uno o más períodos prolongados. En algunos aspectos, la administración incluye tanto la administración directa, incluida la autoadministración, como la administración indirecta, incluido el acto de prescribir un medicamento. Por ejemplo, como se usa aquí, un médico que instruye a un paciente para que se autoadministre un fármaco, o para que otro administre el fármaco y/o que proporciona al paciente una receta para un fármaco, le está administrando el fármaco al paciente.

      Cada realización descrita en este documento se puede usar individualmente o en combinación con cualquier otra realización descrita en este documento.

      Visión de conjunto
      Los poxvirus son virus de ADN grandes (~200 kpb) que se replican en el citoplasma de las células infectadas. El género Orthopoxvirus (OPV) comprende varios poxvirus que varían mucho en su capacidad para infectar a diferentes huéspedes. El virus vaccinia (VACV), por ejemplo, puede infectar a un amplio grupo de huéspedes, mientras que el virus variola (VARV), el agente causal de la viruela, solo infecta a los humanos. Una característica común a muchos, si no a todos los poxvirus, es su capacidad de «reactivarse» de forma no genética dentro de un huésped. La reactivación no genética se refiere a un proceso en el que las células infectadas por un poxvirus pueden promover la recuperación de un segundo virus «muerto» (por ejemplo, uno inactivado por el calor) que no sería infeccioso por sí solo.

      El ADN del poxvirus purificado no es infeccioso porque el ciclo de vida del virus requiere la transcripción de genes tempranos a través de las polimerasas de ARN codificadas por el virus que se empaquetan en los viriones. Sin embargo, esta deficiencia se puede superar si el ADN del virus se transfecta en células previamente infectadas con un poxvirus auxiliar, proporcionando los factores necesarios para transcribir, replicar y empaquetar el genoma transfectado en trans (Sam CK, Dumbell K R. Expression of poxvirus DNA en células coinfectadas y rescate de marcadores de mutantes termosensibles por fragmentos subgenómicos de ADN Ann Virol (Inst Past) 1981; 132:135-50). Aunque esto produce una progenie viral mixta, el problema puede superarse realizando la reacción de reactivación en una línea celular que admita la propagación de ambos virus.

      Anteriormente, un método en el que las reacciones de recombinación de alta frecuencia catalizadas por un leporipoxvirus, el virus del fibroma de Shope (SFV), pueden combinarse con una reacción de reactivación catalizada por SFV, para ensamblar rápidamente cepas recombinantes de VVAC utilizando múltiples fragmentos superpuestos de ADN viral (Yao XD , Evans D H. Recombinación genética de alta frecuencia y reactivación de ortopoxvirus a partir de fragmentos de ADN transfectados en células infectadas con leporipoxvirus. Journal of Virology. 2003; 77(13):7281-90). Por primera vez, se describe la reactivación y caracterización de un poxvirus funcional (virus de la viruela del caballo quimérico sintético [scHPXV]) utilizando fragmentos de ADN de doble cadena superpuestos sintetizados químicamente. Los principios se pueden aplicar y extrapolar de manera análoga a otros poxvirus, incluidos, entre otros, el virus de la viruela del camello (CMLV), el virus de la viruela bovina (CPXV),

      Aquí se muestra además que una realización de un poxvirus quimérico sintético de la invención (p. ej., un virus de la viruela equina quimérico sintético) puede infectar e inmunizar ratones contra una exposición letal al VVAC y puede hacerlo sin causar ninguna enfermedad durante el paso de inmunización inicial.

      Poxvirus quiméricos sintéticos de la invención
      La invención proporciona poxvirus quiméricos sintéticos funcionales (scPV) que inicialmente se replican y ensamblan a partir de ADN sintetizado químicamente. Los virus que se pueden producir de acuerdo con los métodos de la invención pueden ser cualquier poxvirus cuyo genoma haya sido secuenciado en gran parte o para el que se disponga de un aislado natural. Un scPV de la invención puede basarse en las secuencias genómicas de cepas, variantes o mutantes naturales, virus mutagenizados o virus modificados genéticamente. El genoma viral de un scPV de la invención comprende una o más modificaciones con respecto al genoma de tipo salvaje o secuencia del genoma base de dicho virus. Las modificaciones pueden incluir una o más eliminaciones, inserciones, sustituciones o combinaciones de las mismas. Se entiende que las modificaciones pueden introducirse de varias formas comúnmente conocidas en la técnica. Las porciones modificadas del genoma pueden derivar de ADN, ADNc o ADN genómico sintetizado químicamente.

      La síntesis química del genoma es particularmente útil cuando no se dispone de una plantilla natural para la modificación, amplificación o replicación genética mediante métodos convencionales de biología molecular. Por ejemplo, no se dispone fácilmente de un aislado natural del virus de la viruela equina (HPXV) para obtener ADN molde, pero se ha descrito la secuencia del genoma del HPXV (cepa MNR-76). La secuencia del genoma HPXV, sin embargo, está incompleta. No se determinó la secuencia de los bucles en horquilla terminales. En un resultado sorprendente, se generó un HPXV quimérico sintético funcional (scHPXV) mediante el uso de bucles en horquilla terminales basados ​​en telómeros de VACV en lugar de secuencias de bucles en horquilla terminales de HPXV. En algunas realizaciones, el poxvirus pertenece a la subfamilia Chordopoxvirinae. En algunas realizaciones, el poxvirus pertenece a un género de la subfamilia Chordopoxvirinae seleccionado de Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el poxvirus es un Orthopoxvirus. En algunas realizaciones, el Orthopoxvirus se selecciona de virus de la viruela del camello (CMLV), virus de la viruela bovina (CPXV), virus de la ectromelia (ECTV, «agente de la viruela del ratón»), HPXV, virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta virus Taterapox, virus de la enfermedad de Uasin Gishu, virus vaccinia (VACV), virus variólico (VARV) y virus volepox (VPV). En una realización preferida, el poxvirus es un HPXV. En otra realización preferida, el poxvirus es un VACV. En algunas realizaciones, el poxvirus es un Parapoxvirus. En algunas realizaciones, el Parapoxvirus se selecciona de virus orf (ORFV), virus de la pseudoviruela bovina (PCPV), virus de la estomatitis popular bovina (BPSV), parapoxvirus de la ardilla (SPPV), parapoxvirus del ciervo rojo, virus Ausdyk, virus del ecitema contagioso de la gamuza, parapoxvirus del reno o virus de la viruela marina. En algunas realizaciones, el poxvirus es un Molluscipoxvirus. En algunas realizaciones, el Molluscipoxvirus es el virus del molusco contagioso (MCV). En algunas realizaciones, el poxvirus es un Yatapoxvirus. En algunas realizaciones, el Yatapoxvirus se selecciona del virus Tanapox o del virus del tumor del mono Yaba (YMTV). En algunas realizaciones, el poxvirus es un Capripoxvirus. En algunas realizaciones, el Capripoxvirus se selecciona de virus de la enfermedad de la piel nodular contagiosa, de la viruela caprina o del buey ovino. En algunas realizaciones, el poxvirus es un Suipoxvirus. En algunas realizaciones, el Suipoxvirus es el virus de la viruela porcina. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona del virus del mixoma, virus del fibroma de Shope (SFV), virus del fibroma de ardilla o virus del fibroma de liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto.

      La síntesis química del genoma viral también abre la posibilidad de introducir un gran número de modificaciones útiles en el genoma resultante o en partes específicas del mismo. Las modificaciones pueden mejorar la facilidad de clonación para generar el virus, proporcionar sitios para la introducción de productos de genes recombinantes, mejorar la facilidad de identificar clones virales reactivados y/o conferir una plétora de otras características útiles (p. ej., introducir un antígeno deseado, producir un virus oncolítico , etc.). En algunas realizaciones, las modificaciones pueden incluir la atenuación o eliminación de uno o más factores de virulencia. En algunas realizaciones, las modificaciones pueden incluir la adición o inserción de uno o más genes reguladores de la virulencia o factores reguladores que codifican genes.

      Tradicionalmente, las horquillas terminales de los poxvirus han sido difíciles de clonar y secuenciar, por lo que no sorprende que algunas de las secuencias genómicas publicadas (p. ej., VACV, ACAM 2000 y HPXV MNR-76) estén incompletas. La secuencia publicada del genoma de HPXV también está incompleta, probablemente le falten 60 pb en los extremos terminales. Por lo tanto, las horquillas de HPXV no pueden replicarse con precisión y antes de esta invención, no se sabía si HPXV podía replicarse y ensamblarse a partir de polinucleótidos basados ​​únicamente en la parte conocida del genoma de HPXV. Tampoco se sabía que las horquillas de un virus serían operables en otro. En una realización de ejemplo, se sintetizaron químicamente fragmentos de ssDNA de 129 nt utilizando la secuencia publicada de los telómeros del VVAC como guía y se ligaron a fragmentos de dsDNA que comprenden los extremos izquierdo y derecho del genoma de HPXV. En algunas realizaciones, las horquillas terminales de un scPV de la invención se derivan de VACV. En algunas realizaciones, las horquillas terminales se derivan de CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, virus de la viruela del mapache, virus de la viruela del mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu o VPV. En algunas realizaciones, las horquillas terminales se basan en las horquillas terminales de cualquier poxvirus cuyo genoma se haya secuenciado completamente o un aislado natural del cual esté disponible para la secuenciación del genoma.

      En algunas realizaciones, las modificaciones pueden incluir la eliminación de uno o más sitios de restricción. En algunas realizaciones, las modificaciones pueden incluir la introducción de uno o más sitios de restricción. En algunas realizaciones, los sitios de restricción que se eliminarán del genoma o se agregarán al genoma pueden seleccionarse de uno o más sitios de restricción tales como, entre otros, AanI, AarI, AasI, AatI, AatII, AbaSI, AbsI, Acc65I, AccI, AccII, AccIII, Acil, AclI, AcuI, AfeI, AflII, AflIII, AgeI, AhdI, AleI, AluI, AlwI, AlwNI, ApaI, ApaLI, ApeKI, ApoI, AscI, AseI, AsiSI, AvaI, AvaII, AvrIl, BaeGI, BaeI, BamHI BanI, BanII, BbsI, BbvCI, BbvI, BccI, BceAI, BcgI, BciVI, BclI, BcoDI, BfaI, BfuAI, BfuCI, BglI, BglII, BlpI, BmgBI, BmrI, BmtI, BpmI, Bpu10I, BpuEI , BsaAI, BsaBI, BsaHI, BsaI, BsaJI, BsaWI, BsaXI, BseRI, BseYI, BsgI, BsiEI, BsiHKAI, BsiWI, BslI, PluTI, PmeI, PmlI, PpuMI, PshAI, PsiI, PspGI, PspOMI, PspXI, PstI, PvuI, PvuII, RsaI, RsrII, SacI, SacII, SalI, SapI, Sau3AI, Sau96I, SbfI, ScrFI, SexAI, SfaNI, SfcI, SfiI, SfoI, SgrAI, SmaI, SmlI, SnaBI, SpeI, SphI, SrfI, SspI, StuI, StyD4I, StyI, SwaI, TaqαI, TfiI, TseI, Tsp45I, TspMI, TspRI, Tth111I, XbaI, XcmI, XhoI, XmaI, XmnI o ZraI. Se entiende que cualquier sitio de restricción deseado o combinación de sitios de restricción puede insertarse en el genoma o mutarse y/o eliminarse del genoma. En algunas realizaciones, uno o más sitios AarI se eliminan del genoma viral. En algunas realizaciones, uno o más sitios BsaI se eliminan del genoma viral. En algunas realizaciones, uno o más sitios de restricción se eliminan completamente del genoma (por ejemplo, se pueden eliminar todos los sitios AarI en el genoma viral). En algunas realizaciones, uno o más sitios de restricción AvaI se introducen en el genoma viral. En algunas realizaciones, se introducen uno o más sitios StuI en el genoma viral. En algunas realizaciones, la una o más modificaciones pueden incluir la incorporación de objetivos de recombinación que incluyen, entre otros, sitios loxP o FRT.

      En algunas realizaciones, las modificaciones pueden incluir la introducción de marcadores de fluorescencia tales como, entre otros, proteína fluorescente verde (GFP), GFP mejorada, proteína fluorescente amarilla (YFP), proteína fluorescente cian/azul (BFP), proteína fluorescente roja (RFP ), o variantes de los mismos, etc.; marcadores seleccionables como, entre otros, marcadores de resistencia a fármacos (p. ej., gen de la xantina-guanina fosforribosil transferasa (gpt) de E. coli ), Streptomyces albonigergen de puromicina acetiltransferasa (pac), gen de neomicina fosfotransferasa I (nptI), gen de neomicina fosfotransferasa II (nptII), higromicina fosfotransferasa (hpt), gen sh ble, etc.; etiquetas de proteínas o péptidos tales como, entre otros, MBP (proteína de unión a maltosa), CBD (dominio de unión a celulosa), GST (glutatión-S-transferasa), poli(His), FLAG, V5, c-Myc, HA ( hemaglutinina), NE-tag, CAT (cloranfenicol acetil transferasa), DHFR (dihidrofolato reductasa), HSV (virus del herpes simple), VSV-G (glucoproteína del virus de la estomatitis vesicular), luciferasa, proteína A, proteína G, estreptavidina, T7, tiorredoxina , Etiquetas de 2 híbridos de levadura tales como B42, GAL4, LexA o VP16; etiquetas de localización tales como una etiqueta NLS, una etiqueta SNAP, una etiqueta Myr, etc. Se entiende que pueden usarse otros marcadores y/o etiquetas seleccionables conocidos en la técnica. En algunas realizaciones, las modificaciones incluyen uno o más marcadores seleccionables para ayudar en la selección de clones reactivados (p. ej., un marcador de fluorescencia como YFP, un marcador de selección de fármacos como gpt, etc.) para ayudar en la selección de clones virales reactivados. En algunas realizaciones, uno o más marcadores seleccionables se eliminan de los clones reactivados después del paso de selección.

      Los scPV de la invención se pueden usar como vacunas para proteger contra infecciones poxvirales patógenas (p. ej., VARV, MPXV, MCV, ORFV, virus Ausdyk, BPSV, virus de la viruela marina, etc.), como agentes terapéuticos para tratar o prevenir infecciones poxvirales patógenas (p. ej., , VARV, MPXV, MCV, ORFV, virus Ausdyk, BPSV, virus de la viruela marina, etc.), como vehículos para la expresión de genes heterólogos o como agentes oncolíticos. En algunas realizaciones, los scPV de la invención se pueden usar como vacunas para proteger contra la infección por el virus variólico. En algunas realizaciones, los scPV de la invención se pueden usar para tratar o prevenir la infección por virus variólico.

      Métodos de producción de poxvirus quiméricos sintéticos
      La invención proporciona sistemas y métodos para sintetizar, reactivar y aislar poxvirus quiméricos sintéticos funcionales (scPV) a partir de fragmentos de ADN bicatenario superpuestos sintetizados químicamente del genoma viral. La recombinación de fragmentos de ADN superpuestos del genoma viral y la reactivación del scPV funcional se llevan a cabo en células previamente infectadas con un virus auxiliar. Brevemente, los fragmentos de ADN superpuestos que abarcan todo o sustancialmente todo el genoma viral del scPV se sintetizan químicamente y se transfectan en células infectadas con virus auxiliares. Las células transfectadas se cultivan para producir una progenie viral mixta que comprende el virus auxiliar y el scPV reactivado. A continuación, la progenie viral mixta se sembra en placas en células huésped que no favorecen el crecimiento del virus auxiliar pero permiten que crezca el poxvirus quimérico sintético. para eliminar el virus auxiliar y recuperar el poxvirus quimérico sintético. En algunas realizaciones, el virus auxiliar no infecta las células huésped. En algunas realizaciones, el virus auxiliar puede infectar las células hospedantes pero crece pobremente en las células hospedantes. En algunas realizaciones, el virus auxiliar crece más lentamente en las células huésped en comparación con el scPV.

      En algunas realizaciones, sustancialmente todo el genoma poxviral quimérico sintético se deriva de ADN sintetizado químicamente. En algunas realizaciones, alrededor del 40 %, alrededor del 50 %, alrededor del 60 %, alrededor del 70 %, alrededor del 75 %, alrededor del 80 %, alrededor del 85 %, alrededor del 90 %, alrededor del 95 %, alrededor del 96 %, alrededor del 97 %, alrededor del 98 %, alrededor del 99%, más del 99% o el 100% del genoma poxviral quimérico sintético se deriva de ADN sintetizado químicamente. En algunas realizaciones, el genoma poxviral se deriva de una combinación de ADN sintetizado químicamente y ADN natural.

      El número de fragmentos de ADN superpuestos usados ​​en los métodos de la invención dependerá del tamaño del genoma poxviral. Las consideraciones prácticas, como la reducción en la eficiencia de la recombinación a medida que aumenta el número de fragmentos, por un lado, y las dificultades para sintetizar fragmentos de ADN muy grandes a medida que el número de fragmentos disminuye, por otro lado, también informarán sobre el número de fragmentos superpuestos utilizados en los métodos. de la invención En algunas realizaciones, el genoma poxviral quimérico sintético puede sintetizarse como un solo fragmento. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 2-14 fragmentos de ADN superpuestos. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 4-12 fragmentos de ADN superpuestos. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 6-10 fragmentos de ADN superpuestos. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 8-12 fragmentos de ADN superpuestos. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 8-10, 10-12 o 10-14 fragmentos de ADN superpuestos. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 o 15 fragmentos de ADN superpuestos. En algunas realizaciones, el genoma poxviral quimérico sintético se ensambla a partir de 10 fragmentos de ADN superpuestos. En una realización ejemplar de la divulgación, se reactiva un virus de la viruela equina quimérico sintético (scHPXV) a partir de 10 fragmentos de ADN de doble cadena superpuestos sintetizados químicamente. En algunas realizaciones, los bucles en horquilla terminales se sintetizan por separado y se ligan a los fragmentos que comprenden los extremos izquierdo y derecho del genoma poxviral. En algunas realizaciones, los bucles de horquilla terminales pueden derivarse de una plantilla de origen natural. En algunas realizaciones, las horquillas terminales de un scPV de la invención se derivan de VACV. En algunas realizaciones, las horquillas terminales se derivan de CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, virus de la viruela del mapache, virus de la viruela del mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu o VPV. En algunas realizaciones, las horquillas terminales se basan en las horquillas terminales de cualquier poxvirus cuyo genoma se haya secuenciado completamente o un aislado natural del cual esté disponible para la secuenciación del genoma. En algunas realizaciones, todos los fragmentos que abarcan el genoma poxviral se sintetizan químicamente. En algunas realizaciones,

      El tamaño de los fragmentos superpuestos usados ​​en los métodos de la invención dependerá del tamaño del genoma poxviral. Se entiende que puede haber amplias variaciones en los tamaños de los fragmentos y varias consideraciones prácticas, como la capacidad de sintetizar químicamente fragmentos de ADN muy grandes, informarán la elección de los tamaños de los fragmentos. En algunas realizaciones, los fragmentos varían en tamaño desde alrededor de 2.000 pb hasta alrededor de 50.000 pb. En algunas realizaciones, los fragmentos varían en tamaño desde alrededor de 3.000 pb hasta alrededor de 45.000 pb. En algunas realizaciones, los fragmentos varían en tamaño desde aproximadamente 4.000 pb hasta 40.000 pb. En algunas realizaciones, los fragmentos varían en tamaño desde aproximadamente 5000 pb hasta 35000 pb. En algunas realizaciones, los fragmentos más grandes tienen aproximadamente 20 000 pb, 21 000 pb, 22 000 pb, 23 000 pb, 24 000 pb, 25 000 pb, 26 000 pb, 27 000 pb, 28 000 pb, 29 000 pb, 30 000 pb, 31,000 BP, 32,000 BP, 33,000 BP, 34,000 BP, 35,000 BP, 36,000 BP, 37,000 BP, 38,000 BP, 39,000 BP, 40,000 BP, 41,000 BP, 42,000 BP, 43,000 BP, 44,000 BP, 45,000 BP, 46,000 BP, 47,000 BP , 48.000 pb, 49.000 pb o 50.000 pb. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de 10 fragmentos de ADN de doble cadena superpuestos sintetizados químicamente que varían en tamaño desde aproximadamente 8.500 pb hasta aproximadamente 32.000 pb (Tabla 1).

      El virus auxiliar puede ser cualquier poxvirus que pueda proporcionar la maquinaria enzimática que actúa en trans necesaria para reactivar un poxvirus a partir del ADN transfectado. El virus auxiliar puede tener un rango de células huésped diferente o más estrecho que un scPV a producir (p. ej., el virus del fibroma de Shope (SFV) tiene un rango de huéspedes muy estrecho en comparación con los ortopoxvirus como el virus vaccinia (VACV) o HPXV). El virus auxiliar puede tener un fenotipo de placa diferente en comparación con el scPV a producir. En algunas realizaciones, el virus auxiliar es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus es un SFV, virus de fibroma de liebre, virus de fibroma de conejo, virus de fibroma de ardilla o virus de mixoma. En algunas realizaciones, el virus auxiliar es un SFV. En algunas realizaciones, el virus auxiliar es un Orthopoxvirus. En algunas realizaciones, el Orthopoxvirus es un virus de la viruela del camello (CMLV), virus de la viruela bovina (CPXV), virus de la ectromelia (ECTV, “agente de la viruela del ratón”), HPXV, virus de la viruela del simio (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta, virus de Taterapox, virus de la enfermedad de Uasin Gishu, VVAC y virus de la volepox (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. “agente de la viruela del ratón”), HPXV, virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu, virus de la viruela vacuna y volepox (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. “agente de la viruela del ratón”), HPXV, virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu, virus de la viruela vacuna y volepox (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela de la mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu, virus de la viruela vacuna y volepox (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela de la mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu, virus de la viruela vacuna y volepox (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. Taterapox virus, virus de la enfermedad de Uasin Gishu, VACV y volepox virus (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. Taterapox virus, virus de la enfermedad de Uasin Gishu, VACV y volepox virus (VPV). En algunas realizaciones, el virus auxiliar es un Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. Cervidpoxvirus, Crocodylipoxvirus, Molluscipoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el virus auxiliar es un virus de la viruela aviar. En algunas realizaciones, el virus auxiliar es un Alphaentomopoxvirus, Betaentomopoxvirus o Gammaentomopoxvirus. En algunas realizaciones, el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40. el virus auxiliar es un virus auxiliar inactivado con psoraleno. En una realización ejemplar de la descripción, se reactiva un scHPXV a partir de fragmentos de ADN superpuestos transfectados en células BGMK infectadas con SFV. A continuación, el SFV se elimina sembrando la progenie viral mixta en células BSC-40.

      El experto en la materia comprenderá que las células huésped apropiadas que se utilizarán para la reactivación del scPV y la selección y/o aislamiento del scPV dependerán de la combinación particular de virus auxiliar y poxvirus quimérico que se produzca mediante los métodos de la invención. Cualquier célula huésped que soporte el crecimiento tanto del virus auxiliar como del scPV puede usarse para el paso de reactivación y cualquier célula huésped que no soporte el crecimiento del virus auxiliar puede usarse para eliminar el virus auxiliar y seleccionar y/o aislar. el scPV. En algunas realizaciones, el virus auxiliar es un Leporipoxvirus y las células huésped utilizadas para el paso de reactivación pueden seleccionarse de células de riñón de conejo (p. ej., LLC-RK1, RK13, etc.), células de pulmón de conejo (p. ej., R9ab), células de piel de conejo. (p. ej., SF1Ep, DRS, RAB-9), células de córnea de conejo (p. ej., SIRC), células de carcinoma de conejo (p. ej., Oc4T/cc), células de piel/carcinoma de conejo (p. ej., CTPS), células de mono (p. ej., Vero, BGMK, etc.) o células de hámster (p. ej., BHK-21, etc.). En algunas realizaciones, el virus auxiliar es SFV.

      Los scPV de la presente invención se pueden propagar en cualquier sustrato que permita que el virus crezca a títulos que permitan los usos de los scPV descritos en el presente documento. En una realización, el sustrato permite que los scPV crezcan hasta títulos comparables a los determinados para los virus de tipo salvaje correspondientes. Los scPV de la invención pueden cultivarse en células (p. ej., células aviares, células de murciélago, células bovinas, células de camello, células de canario, células de gato, células de ciervo, células equinas, células de aves, células de jerbo, células de cabra, células humanas, células de mono células de cerdo, células de conejo, células de mapache, células de foca, células de oveja, células de mofeta, células de campañol, etc.) que son susceptibles a la infección por los poxvirus. Dichos métodos son bien conocidos por los expertos en la materia. Las células de mamífero representativas incluyen, entre otras, BHK, BGMK, BRL3A, BSC-40, CEF, CEK, CHO, COS, CVI, HaCaT, HEL, células HeLa, HEK293, línea celular de osteosarcoma óseo humano 143B, MDCK, NIH/3T3, células Vero, etc.). Para el aislamiento del virus, el scPV se elimina del cultivo celular y se separa de los componentes celulares, normalmente mediante procedimientos de clarificación bien conocidos, por ejemplo, como centrifugación en gradiente y cromatografía en columna, y puede purificarse adicionalmente según se desee utilizando procedimientos bien conocidos por los expertos en la materia. arte, por ejemplo, ensayos de placa.

      Polinucleótidos de la invención
      La invención proporciona polinucleótidos (p. ej., fragmentos de ADN de doble cadena) para producir poxvirus quiméricos sintéticos funcionales (scPV). La invención proporciona métodos para producir scPV funcionales a partir de ADN sintético (p. ej., ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado, polinucleótidos que comprenden análogos de nucleósidos, etc.). En algunas realizaciones, la invención proporciona métodos para producir scPV funcionales a partir de fragmentos de ADN bicatenario superpuestos sintetizados químicamente del genoma viral. Los polinucleótidos de la invención pueden diseñarse basándose en secuencias genómicas disponibles públicamente. Cuando estén fácilmente disponibles aislados naturales de un poxvirus, el genoma viral puede secuenciarse antes de seleccionar y diseñar los polinucleótidos de la invención. Alternativamente, cuando se disponga de secuencias parciales de ADN de un poxvirus, por ejemplo, a partir de un aislado clínico, de una muestra forense o de ADN amplificado por PCR de material asociado con una persona infectada, el genoma viral parcial puede secuenciarse antes de seleccionar y diseñar los polinucleótidos de la invención. Un scPV de la invención, y por lo tanto, los polinucleótidos de la invención, pueden basarse en las secuencias genómicas de cepas, variantes o mutantes naturales, virus mutagenizados o virus modificados genéticamente.

      La invención proporciona polinucleótidos aislados que incluyen una secuencia de nucleótidos que es al menos 90 % idéntica (p. ej., al menos 91 %, 92 %, 93 % o 94 % idéntica), al menos 95 % idéntica (p. ej., al menos 96 %, 97 % %, 98% o 99% idénticos), o 100% idénticos a la totalidad o una parte de una secuencia del genoma poxviral de referencia o su complemento. Los polinucleótidos aislados de la invención pueden incluir al menos 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 25000, 30000, 35000, 40000, 45000 pb de nucleótidos continuos o no contiguos molécula de polinucleótido de referencia (p. ej., un genoma poxviral de referencia o un fragmento del mismo). Un experto en la técnica apreciará que las secuencias de ácidos nucleicos complementarias a los ácidos nucleicos y las variantes de los ácidos nucleicos también están dentro del alcance de esta invención. En realizaciones adicionales, las secuencias de ácido nucleico de la invención se pueden aislar, recombinar y/o fusionar con una secuencia de nucleótidos heteróloga, o en una biblioteca de ADN.

      En algunos aspectos, la invención proporciona polinucleótidos para producir scPV en los que el poxvirus se selecciona del género Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus o Yatapoxvirus. En algunas realizaciones, el poxvirus es un Orthopoxvirus. En algunas realizaciones, el Orthopoxvirus se selecciona de virus de la viruela del camello (CMLV), virus de la viruela bovina (CPXV), virus de la ectromelia (ECTV, «agente de la viruela del ratón»), HPXV, virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta virus Taterapox, virus de la enfermedad de Uasin Gishu, VVAC, virus variólico (VARV) y virus volepox (VPV). En una realización preferida, el poxvirus es un HPXV. En otra realización preferida, el poxvirus es un VACV. En otra realización preferida, el poxvirus es el clon ACAM2000 de VACV. En otra realización preferida, el poxvirus es la cepa IOC de VVAC (VACV-IOC) (acceso a Genbank KT184690 y KT184691). En otra realización preferida, el genoma de scVACV se basa en el virus Vaccinia modificado Ankara (acceso a Genbank U94848; acceso a Genbank AY603355). En otra realización preferida más, el genoma de scVACV se basa en MVA-BN (Acceso a Genbank DQ983238). En algunas realizaciones, el poxvirus es un Parapoxvirus. En algunas realizaciones, el Parapoxvirus se selecciona de orf virus (ORFV), pseudovirus de la viruela bovina (PCPV), virus de la estomatitis popular bovina (BPSV), parapoxvirus de la ardilla (SPPV), parapoxvirus del ciervo rojo, virus Ausdyk, virus del ecitema contagioso de la gamuza, parapoxvirus del reno, o el virus de la viruela marina. En algunas realizaciones, el poxvirus es un Molluscipoxvirus. En algunas realizaciones, el Molluscipoxvirus es el virus del molusco contagioso (MCV). En algunas realizaciones, el poxvirus es un Yatapoxvirus. En algunas realizaciones, el Yatapoxvirus se selecciona del virus Tanapox o del virus del tumor del mono Yaba (YMTV). En algunas realizaciones, el poxvirus es un Capripoxvirus. En algunas realizaciones, el Capripoxvirus se selecciona de virus de la enfermedad de la piel nodular contagiosa, de la viruela caprina o del buey ovino. En algunas realizaciones, el poxvirus es un Suipoxvirus. En algunas realizaciones, el Suipoxvirus es el virus de la viruela porcina. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto. En algunas realizaciones, el Yatapoxvirus se selecciona del virus Tanapox o del virus del tumor del mono Yaba (YMTV). En algunas realizaciones, el poxvirus es un Capripoxvirus. En algunas realizaciones, el Capripoxvirus se selecciona de virus de la enfermedad de la piel nodular contagiosa, de la viruela caprina o del buey ovino. En algunas realizaciones, el poxvirus es un Suipoxvirus. En algunas realizaciones, el Suipoxvirus es el virus de la viruela porcina. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto. En algunas realizaciones, el Yatapoxvirus se selecciona del virus Tanapox o del virus del tumor del mono Yaba (YMTV). En algunas realizaciones, el poxvirus es un Capripoxvirus. En algunas realizaciones, el Capripoxvirus se selecciona de virus de la enfermedad de la piel nodular contagiosa, de la viruela caprina o del buey ovino. En algunas realizaciones, el poxvirus es un Suipoxvirus. En algunas realizaciones, el Suipoxvirus es el virus de la viruela porcina. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto. el poxvirus es un Capripoxvirus. En algunas realizaciones, el Capripoxvirus se selecciona de virus de la enfermedad de la piel nodular contagiosa, de la viruela caprina o del buey ovino. En algunas realizaciones, el poxvirus es un Suipoxvirus. En algunas realizaciones, el Suipoxvirus es el virus de la viruela porcina. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto. el poxvirus es un Capripoxvirus. En algunas realizaciones, el Capripoxvirus se selecciona de virus de la enfermedad de la piel nodular contagiosa, de la viruela caprina o del buey ovino. En algunas realizaciones, el poxvirus es un Suipoxvirus. En algunas realizaciones, el Suipoxvirus es el virus de la viruela porcina. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto. En algunas realizaciones, el poxvirus es un Leporipoxvirus. En algunas realizaciones, el Leporipoxvirus se selecciona entre el virus del mixoma, el virus del fibroma de Shope (SFV), el virus del fibroma de la ardilla o el virus del fibroma de la liebre. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede estar basado en un poxvirus recientemente descubierto.

      CONTINUA EN EL SIGUIENTE POST ————————————————————————————➤

      1. Zack Saetonious

        En algunos aspectos, el scPV es un CMLV cuyo genoma se basa en una secuencia genómica publicada (p. ej., cepa CMS (Acceso a Genbank AY009089.1)). En algunos aspectos, el scPV es un CPXV cuyo genoma se basa en una secuencia genómica publicada (p. ej., cepa Brighton Red (Genbank Accession AF482758), cepa GRI-90 (Genbank Accession X94355)). En algunos aspectos, el scPV es un ECTV cuyo genoma se basa en una secuencia genómica publicada (p. ej., cepa Moscow (Acceso a Genbank NC_004105)). En algunos aspectos, el scPV es un MPXV cuyo genoma se basa en una secuencia genómica publicada (p. ej., cepa Zaire-96-1-16 (Acceso a Genbank AF380138)). En algunos aspectos, el scPV es un RPXV cuyo genoma se basa en una secuencia genómica publicada (p. ej., cepa Utrecht (Acceso a Genbank AY484669)). En algunos aspectos,

        En un aspecto, la invención proporciona polinucleótidos para producir un virus de la viruela equina quimérico sintético (scHPXV). En una realización específica, el genoma de scHPXV puede basarse en la secuencia del genoma descrita para la cepa MNR-76 de HPXV (SEQ ID NO: 49) (Tulman ER, Delhon G, Afonso CL, Lu Z, Zsak L, Sandybaev NT, et al. Genoma del virus de la viruela equina, Journal of Virology, 2006, 80(18):9244-58). Esta secuencia del genoma está incompleta y parece no incluir la secuencia de los bucles terminales en horquilla. Aquí se muestra que los bucles en horquilla terminales del virus vaccinia (VACV) pueden ligarse a los extremos del genoma de HPXV para producir partículas de scHPXV funcionales usando los métodos de la invención. El genoma de HPXV se puede dividir en 10 fragmentos superpuestos como se describe en los ejemplos de trabajo de la divulgación y se muestra en la Tabla 1. En algunas realizaciones, el genoma se puede dividir en 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 o 15 fragmentos superpuestos. En algunas realizaciones, el genoma completo se puede proporcionar como un fragmento. Las ubicaciones genómicas de los ejemplos de fragmentos superpuestos y los tamaños de los fragmentos se muestran en la Tabla 1. La Tabla 2 muestra algunas de las modificaciones que se pueden realizar en estos fragmentos en relación con la secuencia de bases. Los polinucleótidos de la invención comprenden secuencias de ácidos nucleicos que son al menos 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98 %, 99 % o 100 % idénticos a SEQ ID NO: 1-10. En algunas realizaciones, un polinucleótido aislado de la invención comprende una variante de estas secuencias, donde dichas variantes pueden incluir mutaciones sin sentido, mutaciones sin sentido, duplicaciones, deleciones y/o adiciones. SEQ ID NO: 11 y SEQ ID NO: 12 representan las secuencias de nucleótidos de los bucles terminales en horquilla de VCV (cepa WR). En algunas realizaciones, los bucles en horquilla terminales comprenden secuencias de ácido nucleico que son al menos 70 %, 75 %, 80 %, 85 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98%, 99% o 100% idéntico a SEQ ID NO: 11 o SEQ ID NO: 12.

        La invención proporciona polinucleótidos aislados que incluyen una secuencia de nucleótidos que es al menos 90 % idéntica (p. ej., al menos 91 %, 92 %, 93 % o 94 % idéntica), al menos 95 % idéntica (p. ej., al menos 96 %, 97 % %, 98 % o 99 % idénticos), o 100 % idénticos a la totalidad o una parte de una secuencia del genoma de HPXV de referencia (p. ej., SEQ ID NO: 49). En algunas realizaciones, un polinucleótido aislado de la invención comprende una variante de las secuencias de referencia, donde dichas variantes pueden incluir mutaciones sin sentido, mutaciones sin sentido, duplicaciones, deleciones y/o adiciones. Los polinucleótidos aislados de la invención pueden incluir al menos 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 25000, 30000, 35000, 40000,

        En otro aspecto, la invención proporciona polinucleótidos para producir un VVAC quimérico sintético (scVACV). En una realización específica, el genoma de scVACV se basa en un genoma de VACV publicado. En una realización específica, el genoma de scVACV se basa en la cepa ACAM2000; Acceso a Genbank AY313847). En una realización específica, el genoma de scVACV se basa en VACV-IOC (acceso a Genbank KT184690 y KT184691). En una realización específica, el genoma de scVACV se basa en el virus Vaccinia modificado Ankara (acceso a Genbank U94848; acceso a Genbank AY603355). En una realización específica, el genoma de scVACV se basa en MVA-BN (Acceso a Genbank DQ983238). El genoma del VVAC se puede dividir en 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 o 15 fragmentos superpuestos. En algunas realizaciones, el genoma completo se puede proporcionar como un fragmento. En una realización específica, el genoma del VVAC se divide en nueve fragmentos superpuestos como se muestra en la Tabla 7. Los polinucleótidos de la invención comprenden secuencias de ácidos nucleicos que son al menos 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 % o 100 % idénticos a SEQ ID NO: 50-58. En algunas realizaciones, un polinucleótido aislado de la invención comprende una variante de estas secuencias, donde dichas variantes pueden incluir mutaciones sin sentido, mutaciones sin sentido, duplicaciones, deleciones y/o adiciones. En otras realizaciones, el genoma de scVACV se basa en una cepa de VACV seleccionada de Western Reserve (Acceso a Genbank NC 006998; Acceso a Genbank AY243312), CL3 (Acceso a Genbank AY313848), Tian Tian (Acceso a Genbank AF095689.1), Tian Tian clones TT9 ( JX489136), TP3 (Acceso a Genbank KC207810) y TP5 (Acceso a Genbank KC207811), NYCBH, Wyeth, DPP21 (Acceso a Genbank JN654986). El genoma del VVAC se puede dividir en 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 o 15 fragmentos superpuestos. En algunas realizaciones, el genoma completo se puede proporcionar como un fragmento.

        La invención proporciona en una realización polinucleótidos aislados que incluyen una secuencia de nucleótidos que es al menos 90 % idéntica (p. ej., al menos 91 %, 92 %, 93 % o 94 % idéntica), al menos 95 % idéntica (p. ej., al menos 96 % %, 97 %, 98 % o 99 % idénticos), o 100 % idénticos a la totalidad o una parte de una secuencia del genoma de referencia o su complemento (p. ej., VVAC). En algunas realizaciones, un polinucleótido aislado de la invención comprende una variante de las secuencias de referencia, donde dichas variantes pueden incluir mutaciones sin sentido, mutaciones sin sentido, duplicaciones, deleciones y/o adiciones. Los polinucleótidos aislados de la invención pueden incluir al menos 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 25000, 30000, 35000, 40000,

        Los polinucleótidos complementarios a cualquiera de las secuencias de polinucleótidos descritas en el presente documento también están incluidos en la presente invención. Los polinucleótidos pueden ser monocatenarios (codificantes o antisentido) o bicatenarios, y pueden ser moléculas de ADN (genómico o sintético) o ARN. Las moléculas de ARN incluyen moléculas de ARNm. Las secuencias codificantes o no codificantes adicionales pueden estar presentes, pero no necesariamente, dentro de un polinucleótido de la presente invención, y un polinucleótido puede, pero no necesariamente, estar unido a otras moléculas y/o materiales de soporte.

        Se dice que dos secuencias de polinucleótidos o polipéptidos son «idénticas» si la secuencia de nucleótidos o aminoácidos en las dos secuencias es la misma cuando se alinean para una máxima correspondencia como se describe a continuación. Las comparaciones entre dos secuencias normalmente se realizan comparando las secuencias en una ventana de comparación para identificar y comparar regiones locales de similitud de secuencia. Una «ventana de comparación», como se usa aquí, se refiere a un segmento de al menos unas 20 posiciones contiguas, normalmente de 30 a unas 75, o de 40 a unas 50, en el que una secuencia se puede comparar con una secuencia de referencia del mismo número de posiciones contiguas. posiciones después de que las dos secuencias estén óptimamente alineadas.

        Los polinucleótidos o variantes también pueden, o alternativamente, ser sustancialmente homólogos a un polinucleótido proporcionado en el presente documento. Dichas variantes de polinucleótidos son capaces de hibridarse en condiciones moderadamente estrictas con un polinucleótido de la invención (o su complemento).

        Las “condiciones moderadamente estrictas” adecuadas incluyen el prelavado en una solución de 5x SSC, SDS al 0,5 %, EDTA 1,0 mM (pH 8,0); hibridación a 50°C-65°C, 5x SSC, durante la noche; seguido de lavado dos veces a 65ºC durante 20 minutos con SSC 2X, 0,5X y 0,2X que contenía SDS al 0,1%.

        Tal como se utiliza en el presente documento, «condiciones muy estrictas» o «condiciones de alta rigurosidad» son aquellas que: (1) emplean una fuerza iónica baja y una temperatura alta para el lavado, por ejemplo, cloruro de sodio 0,015 M/citrato de sodio 0,0015 M/dodecilsulfato de sodio al 0,1 % a 50°C; (2) emplear durante la hibridación un agente desnaturalizante, como formamida, por ejemplo, formamida al 50 % (v/v) con albúmina de suero bovino al 0,1 %/ficoll al 0,1 %/polivinilpirrolidona al 0,1 %/tampón de fosfato de sodio 50 mM a pH 6,5 con 750 cloruro de sodio mM, citrato de sodio 75 mM a 42ºC; o (3) emplear formamida al 50 %, SSC 5x (NaCl 0,75 M, citrato de sodio 0,075 M), fosfato de sodio 50 mM (pH 6,8), pirofosfato de sodio al 0,1 %, solución de Denhardt 5x, ADN de esperma de salmón sonicado (50 μg/ ml), SDS al 0,1% y sulfato de dextrano al 10% a 42°C, con lavados a 42°C en 0.

        Los polinucleótidos de esta invención se pueden obtener usando síntesis química, métodos recombinantes o PCR. Los métodos de síntesis química de polinucleótidos son bien conocidos en la técnica y no es necesario describirlos en detalle en este documento. Un experto en la técnica puede usar las secuencias proporcionadas en este documento y un sintetizador de ADN comercial para producir una secuencia de ADN deseada.

        Para preparar polinucleótidos utilizando métodos recombinantes, se puede insertar un polinucleótido que comprende una secuencia deseada en un vector adecuado y, a su vez, el vector se puede introducir en una célula huésped adecuada para la replicación y amplificación, como se analiza más adelante en este documento. Los polinucleótidos se pueden insertar en las células huésped por cualquier medio conocido en la técnica. Las células se transforman introduciendo un polinucleótido exógeno mediante captación directa, endocitosis, transfección, acoplamiento F o electroporación. Una vez introducido, el polinucleótido exógeno se puede mantener dentro de la célula como un vector no integrado (como un plásmido) o integrado en el genoma de la célula huésped. El polinucleótido así amplificado se puede aislar de la célula huésped mediante métodos bien conocidos en la técnica. Véase, por ejemplo, Sambrook et al., 1989.

        Alternativamente, la PCR permite la reproducción de secuencias de ADN. La tecnología PCR es bien conocida en la técnica y se describe en la patente de EE.UU. Nos. 4.683.195, 4.800.159, 4.754.065 y 4.683.202, así como PCR: The Polymerase Chain Reaction, Mullis et al. editores, Birkauswer Press, Boston, 1994.

        El ARN se puede obtener usando el ADN aislado en un vector apropiado e insertándolo en una célula huésped adecuada. Cuando la célula se replica y el ADN se transcribe en ARN, el ARN se puede aislar utilizando métodos bien conocidos por los expertos en la técnica, como se establece en Sambrook et al., 1989, supra, por ejemplo.

        En otras realizaciones, los ácidos nucleicos de la invención también incluyen secuencias de nucleótidos que se hibridan en condiciones muy estrictas con las secuencias de nucleótidos expuestas en SEQ ID NO: 1-10 o 50-58, o secuencias complementarias a las mismas. Un experto normal en la técnica entenderá fácilmente que pueden variarse las condiciones de rigurosidad apropiadas que promueven la hibridación del ADN. Por ejemplo, se podría realizar la hibridación a 6,0x cloruro de sodio/citrato de sodio (SSC) a aproximadamente 45 °C, seguido de un lavado de 2,0xSSC a 50 °C. Por ejemplo, la concentración de sal en el paso de lavado puede seleccionarse desde una rigurosidad baja de aproximadamente 2,0 × SSC a 50 °C hasta una rigurosidad alta de aproximadamente 0,2 × SSC a 50 °C. Además, la temperatura en la etapa de lavado se puede aumentar desde condiciones de baja rigurosidad a temperatura ambiente, unos 22°C, a condiciones de alta rigurosidad a aproximadamente 65ºC. Tanto la temperatura como la sal pueden variarse, o la temperatura o la concentración de sal pueden mantenerse constantes mientras se cambia la otra variable. En una realización, la invención proporciona ácidos nucleicos que se hibridan en condiciones de baja rigurosidad de 6xSSC a temperatura ambiente seguido de un lavado a 2xSSC a temperatura ambiente.

        Los ácidos nucleicos aislados que difieren debido a la degeneración del código genético también están dentro del alcance de la invención. Por ejemplo, varios aminoácidos se designan con más de un triplete. Los codones que especifican el mismo aminoácido o los sinónimos (por ejemplo, CAU y CAC son sinónimos de histidina) pueden provocar mutaciones «silenciosas» que no afectan la secuencia de aminoácidos de la proteína. Un experto en la técnica apreciará que estas variaciones en uno o más nucleótidos (hasta aproximadamente el 3-5% de los nucleótidos) de los ácidos nucleicos que codifican una proteína particular pueden existir entre los miembros de una especie dada debido a la variación alélica natural. Todas y cada una de tales variaciones de nucleótidos y los polimorfismos de aminoácidos resultantes están dentro del alcance de esta invención.

        La presente invención proporciona además vectores de clonación recombinantes y vectores de expresión que son útiles para clonar un polinucleótido de la presente invención. La presente invención proporciona además células huésped transformadas que comprenden una molécula polinucleotídica o un vector recombinante de la invención, y nuevas cepas o líneas celulares derivadas de las mismas.

        Una célula huésped puede ser una célula bacteriana, una célula de levadura, una célula de hongo filamentoso, una célula de alga, una célula de insecto o una célula de mamífero. En algunas realizaciones, la célula huésped es E. coli . Se ha desarrollado una variedad de vectores diferentes para uso específico en cada una de estas células huésped, incluidos fagos, plásmidos con un número alto de copias, plásmidos con un número bajo de copias y vectores lanzadera, entre otros, y cualquiera de estos puede usarse para poner en práctica la presente invención. .

        Los vectores de clonación adecuados se pueden construir de acuerdo con técnicas estándar, o se pueden seleccionar de un gran número de vectores de clonación disponibles en la técnica. Si bien el vector de clonación seleccionado puede variar según la célula huésped que se pretenda utilizar, los vectores de clonación útiles generalmente tendrán la capacidad de autorreplicarse, pueden poseer un solo objetivo para una endonucleasa de restricción particular y/o pueden portar genes para un marcador. que se puede utilizar en la selección de clones que contienen el vector. Los ejemplos adecuados incluyen plásmidos y virus bacterianos, p. ej., pBAD18, pUC18, pUC19, Bluescript (p. ej., pBS SK+) y sus derivados, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, ADN de fago y vectores lanzadera como pSA3 y pAT28. Estos y muchos otros vectores de clonación están disponibles de proveedores comerciales como BioRad, Strategene e Invitrogen.

        Para ayudar en la selección de células huésped transformadas o transfectadas con vectores de clonación de la presente invención, el vector se puede diseñar para que comprenda además una secuencia codificante para un producto de gen informador u otro marcador seleccionable. Tal secuencia de codificación está preferentemente en asociación operativa con las secuencias de codificación del elemento regulador, como se ha descrito anteriormente. Los genes indicadores que son útiles en la invención son bien conocidos en la técnica e incluyen aquellos que codifican proteína verde fluorescente, luciferasa, xylE y tirosinasa, entre otros. Las secuencias de nucleótidos que codifican marcadores seleccionables son bien conocidas en la técnica e incluyen aquellas que codifican productos génicos que confieren resistencia a antibióticos o antimetabolitos, o que proporcionan un requisito auxotrófico. Ejemplos de tales secuencias incluyen aquellas que codifican resistencia a ampicilina, eritromicina,

        Los vectores que contienen los polinucleótidos de interés y/o los propios polinucleótidos pueden introducirse en la célula huésped por cualquiera de varios medios apropiados, incluida la electroporación, la transfección empleando cloruro de calcio, cloruro de rubidio, fosfato de calcio, DEAE-dextrano u otros sustancias; bombardeo de microproyectiles; lipofección; e infección (p. ej., cuando el vector es un agente infeccioso tal como el virus vaccinia). La elección de introducir vectores o polinucleótidos a menudo dependerá de las características de la célula huésped.

        La presente invención proporciona además células huésped transformadas que comprenden una molécula polinucleotídica o un vector recombinante de la invención, y nuevas cepas o líneas celulares derivadas de las mismas. En algunas realizaciones, las células huésped útiles en la práctica de la invención son células de E. coli . Normalmente se puede utilizar una cepa de E. coli , como por ejemplo, E. coli TOP 10, o E. coli BL21 (DE3), DH5α, etc., disponibles en la Colección Americana de Cultivos Tipo (ATCC), 10801 University Blvd. , Manassas, Va. 20110, EE. UU. y de fuentes comerciales. En algunas realizaciones, se pueden usar otras células procariotas o células eucariotas. En algunas realizaciones, la célula huésped es miembro de un género seleccionado de:Clostridium, Zymomonas, Escherichia, Salmonella, Serratia, Erwinia, Klebsiella, Shigella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Alcaligenes, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Schizosaccharomyces, Kluyveromyces, Yarrowia, Pichia, Candida, Pichiamyces o Sac . Dichas células huésped transformadas normalmente incluyen, pero no se limitan a, microorganismos, tales como bacterias transformadas con vectores de ADN de bacteriófagos recombinantes, ADN de plásmidos o ADN de cósmidos, o levaduras transformadas con vectores recombinantes, entre otros. Las células huésped eucarióticas preferidas incluyen células de levadura, aunque también se pueden utilizar eficazmente células de mamífero o células de insecto. Las células huésped adecuadas incluyen procariotas (tales como E. coli, B. subtillis, S. lividans oC. glutamicum ) y levaduras (tales como S. cerevisae, S. pombe, P. pastoris o K. lactis ).

        En un aspecto, la invención también incluye el genoma del scPV, sus recombinantes o partes funcionales del mismo. Una parte funcional del genoma viral puede ser una porción del genoma que codifica una proteína o una porción de la misma (p. ej., dominio, epítopo, etc.), una porción que comprende elementos reguladores o componentes de elementos reguladores como un promotor, potenciador, elementos que actúan en cis o trans, etc. Dichas secuencias virales pueden usarse para identificar o aislar el virus o sus recombinantes, por ejemplo, usando PCR, tecnologías de hibridación o estableciendo ensayos ELISA.

        Usos ejemplares
        Prevención o tratamiento de infecciones poxvirales patógenas
        Los poxvirus quiméricos sintéticos (scPV) de la invención pueden usarse en la inmunización de un sujeto contra una infección poxviral patógena. Los scPV de la invención se pueden usar para prevenir, manejar o tratar una o más infecciones poxvirales patógenas en un sujeto. En algunas realizaciones, el poxvirus patógeno es un Orthopoxvirus (por ejemplo, virus de la viruela del camello (CMLV), virus de la viruela vacuna (CPXV), virus de la ectromelia (ECTV, «agente de la viruela del ratón»), HPXV, virus de la viruela del mono (MPXV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del mofeta, virus de Taterapox, virus de la enfermedad de Uasin Gishu, virus vaccinia (VACV), virus variólico (VARV) y virus volepox (VPV)). En algunas realizaciones, el poxvirus patógeno es un Parapoxvirus (p. ej., orfvirus (ORFV), pseudovirus de la viruela bovina (PCPV), virus de la estomatitis popular bovina (BPSV), parapoxvirus de la ardilla (SPPV), parapoxvirus del ciervo rojo, virus Ausdyk, virus del ecitema contagioso de la gamuza, parapoxvirus del reno o virus de la viruela marina). En algunas realizaciones, el poxvirus patógeno es un moluscipoxvirus (p. ej., virus del molusco contagioso (MCV)). En algunas realizaciones, el poxvirus patógeno es un Yatapoxvirus (por ejemplo, el virus Tanapox o el virus del tumor del mono Yaba (YMTV)). En algunas realizaciones, el poxvirus patógeno es un Capripoxvirus (p. ej., virus del buey ovino, de la viruela caprina o de la enfermedad cutánea nodular contagiosa). En algunas realizaciones, el poxvirus es un Suipoxvirus (por ejemplo, el virus de la viruela porcina). En algunas realizaciones, el poxvirus patógeno es un Leporipoxvirus (p. ej., virus del mixoma, virus del fibroma de Shope (SFV), virus del fibroma de la ardilla o virus del fibroma de la liebre). En algunas realizaciones, el poxvirus patógeno es el virus variólico. En algunas realizaciones, el poxvirus patógeno es MPXV. En algunas realizaciones, el poxvirus patógeno es MCV. En algunas realizaciones, el poxvirus patógeno es ORFV. En algunas realizaciones, el poxvirus patógeno es CPXV. El poxvirus patógeno puede ser un pseudotipo o quimera de poxvirus. En algunas realizaciones, el sujeto es un sujeto humano. En algunas realizaciones, el sujeto es un sujeto animal. Todavía se descubren constantemente nuevos poxvirus (p. ej., ortopoxvirus). Se entiende que un scPV de la invención puede usarse en la inmunización de un sujeto contra un poxvirus patógeno recién descubierto o en la prevención, manejo o tratamiento de una infección por un poxvirus patógeno recién descubierto. Orthopoxviruses) todavía se descubren constantemente. Se entiende que un scPV de la invención puede usarse en la inmunización de un sujeto contra un poxvirus patógeno recién descubierto o en la prevención, manejo o tratamiento de una infección por un poxvirus patógeno recién descubierto. Orthopoxviruses) todavía se descubren constantemente. Se entiende que un scPV de la invención puede usarse en la inmunización de un sujeto contra un poxvirus patógeno recién descubierto o en la prevención, manejo o tratamiento de una infección por un poxvirus patógeno recién descubierto.

        Los scPV de la invención se pueden usar en formulaciones inmunogénicas, por ejemplo, formulaciones de vacunas. Las formulaciones se pueden usar para prevenir, manejar, neutralizar, tratar y/o mejorar una infección poxviral patógena. Las formulaciones inmunogénicas pueden comprender un scPV vivo o inactivado de la invención. El scPV se puede inactivar mediante métodos bien conocidos por los expertos en la técnica. Los métodos comunes usan formalina y calor para la inactivación. En algunas realizaciones, la formulación inmunogénica comprende una vacuna viva. La producción de tales formulaciones inmunogénicas vivas puede lograrse utilizando métodos convencionales que implican la propagación del scPV en cultivo celular seguido de purificación. Por ejemplo, el scPV se puede cultivar en células BHK, BGMK, BRL3A, BSC-40, CEF, CEK, CHO, COS, CVI, HaCaT, HEL, HeLa, HEK293, línea celular de osteosarcoma óseo humano 143B, MDCK,

        En un aspecto, los scPV de la invención pueden usarse para prevenir, controlar o tratar la viruela. Los scPV de la invención (p. ej., un VPH quimérico sintético (scHPXV) o un VVAC quimérico sintético (scVACV)) se pueden usar como vacuna para la prevención de la viruela en individuos o poblaciones que han estado expuestos, potencialmente expuestos o están en riesgo de exposición a la viruela. Los scPV de la invención pueden usarse para crear una nueva reserva nacional de vacuna contra la viruela (por ejemplo, un scHPXV o scVACV de la invención). En algunas realizaciones, los scPV de la invención pueden administrarse profilácticamente al personal de defensa, socorristas, etc.

        En una realización, una composición que comprende un scHPXV de la invención se usa como vacuna contra la viruela. Aquí se muestra que un scHPXV producido de acuerdo con los métodos de la invención tiene un fenotipo de placa pequeña. En general, se considera que un fenotipo de placa pequeña refleja atenuación. Por consiguiente, un scHPXV producido según los métodos de la invención proporciona una alternativa segura a las vacunas contra la viruela existentes. En algunas realizaciones, la vacuna puede ser segura para la administración a sujetos inmunodeprimidos (p. ej., pacientes con VIH, pacientes que reciben quimioterapia, pacientes que reciben tratamiento para el cáncer, trastornos reumatológicos o trastornos autoinmunitarios, pacientes que se someten o han recibido un trasplante de órganos o tejidos, pacientes con inmunodeficiencias, niños, mujeres embarazadas, pacientes con dermatitis atópica, eccema, psoriasis, afecciones cardíacas y pacientes con inmunosupresores, etc.) que pueden sufrir complicaciones graves debido a una vacuna contra la viruela existente y, por lo tanto, están contraindicados para una vacuna contra la viruela existente. En algunas realizaciones, la vacuna puede usarse en combinación con uno o más tratamientos antivirales para suprimir la replicación viral. En algunas realizaciones, la vacuna se puede usar en combinación con el tratamiento con brincidofovir para suprimir la replicación viral. En algunas realizaciones, la vacuna se puede usar en combinación con el tratamiento con tecovirimat/SIGA-246 para suprimir la replicación viral. En algunas realizaciones, la vacuna se puede usar en combinación con fosfonatos de nucleósidos acíclicos (cidofovir), profármacos alcoxialquilo orales de nucleósidos acíclicos o fosfonatos (brincidofovir o CMX001). En algunas realizaciones, la vacuna se puede usar en combinación con inmunoglobulina vaccinia (VIG). En algunas realizaciones, la vacuna puede usarse en sujetos que han sido inmunizados previamente con antígenos peptídicos o proteicos derivados de VACV, VARV o HPXV. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con VVAC muertos o inactivados. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con la cepa del virus VACV de replicación deficiente/defectuosa, MVA (virus modificado de Ankara). Una formulación de vacuna que comprende un scHPXV de la invención puede comprender un scHPXV vivo o inactivado. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con VVAC muertos o inactivados. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con la cepa del virus VACV de replicación deficiente/defectuosa, MVA (virus modificado de Ankara). Una formulación de vacuna que comprende un scHPXV de la invención puede comprender un scHPXV vivo o inactivado. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con VVAC muertos o inactivados. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con la cepa del virus VACV de replicación deficiente/defectuosa, MVA (virus modificado de Ankara). Una formulación de vacuna que comprende un scHPXV de la invención puede comprender un scHPXV vivo o inactivado.

        En una realización, una composición que comprende un scVACV de la invención se usa como vacuna contra la viruela. El scVACV puede basarse en una cepa de VACV seleccionada de ACAM2000 (Acceso a Genbank AY313847), Western Reserve (Acceso a Genbank NC 006998; Acceso a Genbank AY243312), CL3 (Acceso a Genbank AY313848), Tian Tian (Acceso a Genbank AF095689.1), Tian Tian clones TT9 (JX489136), TP3 (Acceso a Genbank KC207810) y TP5 (Acceso a Genbank KC207811), NYCBH, Wyeth, Copenhagen (Acceso a Genbank M35027), Lister 107 (Acceso a Genbank DQ121394) Lister-LO (Acceso a Genbank AY678276), virus vaccinia modificado Ankara (MVA) (Acceso a Genbank U94848; Acceso a Genbank AY603355), MVA-BN (Acceso a Genbank DQ983238), Lederle, Tashkent clones TKT3 (Acceso a Genbank KM044309) y TKT4 (KM044310), URSS, Evans, Praga, LIVP, Ikeda, IHD-W (Acceso a Genbank KJ125439), LC16m8 (AY678275), EM-63, IC, Malbran, Duke (Acceso a Genbank DQ439815), 3737 (Acceso a Genbank DQ377945), CV-1, Connaught Laboratories, CVA (Acceso a Genbank AM501482), Virus Serro 2 (Acceso a Genbank KF179385), aislado de virus Cantaglo CM-01 (Acceso a Genbank KT013210), Clones Dryvax DPP15 (Acceso a Genbank JN654981), DPP20 (Acceso a Genbank JN654985), DPP13 (Acceso a Genbank JN654980), DPP17 (Acceso a Genbank JN654983) , DPP21 (Acceso a Genbank JN654986) e IOC (Acceso a Genbank KT184690 y KT184691). En una realización, el scVACV que se utilizará como vacuna contra la viruela se basa en la cepa ACAM2000 (Acceso a Genbank AY313847). En una realización, el scVACV a utilizar como vacuna contra la viruela se basa en la cepa VACV-IOC (acceso a Genbank KT184690 y KT184691). En una realización, el scVAVC que se va a utilizar como vacuna contra la viruela se basa en la cepa MVA (Acceso a Genbank U94848; Acceso a Genbank AY603355). En una realización, el scVACV que se utilizará como vacuna contra la viruela se basa en la cepa MVA-BN (Acceso a Genbank DQ983238). Una formulación de vacuna que comprende un scPV de la invención puede comprender un scVACV vivo o inactivado.

        En algunas realizaciones, una composición que comprende un scPV de la invención (p. ej., un scHPXV o un scVACV) se usa como vacuna contra una infección por VACV, una infección por MPXV o una infección por CPXV.

        En algunas realizaciones, un scPV de la invención puede diseñarse para expresar antígenos o epítopos heterólogos y puede usarse como vacunas contra los organismos fuente de dichos antígenos y/o epítopos.

        Las formulaciones inmunogénicas de la presente invención (p. ej., vacunas) comprenden una cantidad eficaz de un scPV de la invención y un vehículo farmacéuticamente aceptable. El término «farmacéuticamente aceptable» significa aprobado por una agencia reguladora del gobierno federal o estatal o enumerado en la Farmacopea de EE. UU. u otras farmacopeas generalmente reconocidas para uso en animales, y más particularmente en humanos. El término «vehículo» se refiere a un diluyente, adyuvante, excipiente o vehículo con el que se administra la composición farmacéutica (p. ej., formulación inmunogénica o de vacuna). Las soluciones salinas y las soluciones acuosas de dextrosa y glicerol también se pueden emplear como vehículos líquidos, particularmente para soluciones inyectables. Los excipientes adecuados incluyen almidón, glucosa, lactosa, sacarosa, gelatina, malta, arroz, harina, tiza, gel de sílice, estearato de sodio, monoestearato de glicerol, talco, cloruro de sodio, leche desnatada en polvo, glicerol, propileno, glicol, agua, etanol y similares. Los ejemplos de vehículos farmacéuticos adecuados se describen en «Remington’s Pharmaceutical Sciences» de EW Martin. La formulación debe adaptarse al modo de administración. La formulación particular también puede depender de si el scPV está vivo o inactivado. Los scPV purificados de la invención pueden liofilizarse para su uso posterior o pueden prepararse inmediatamente en una solución farmacéutica. Los scPV también pueden diluirse en una solución fisiológicamente aceptable, como solución salina estéril, con o sin adyuvante o vehículo. s Ciencias Farmacéuticas” por EW Martin. La formulación debe adaptarse al modo de administración. La formulación particular también puede depender de si el scPV está vivo o inactivado. Los scPV purificados de la invención pueden liofilizarse para su uso posterior o pueden prepararse inmediatamente en una solución farmacéutica. Los scPV también pueden diluirse en una solución fisiológicamente aceptable, como solución salina estéril, con o sin adyuvante o vehículo. s Ciencias Farmacéuticas” por EW Martin. La formulación debe adaptarse al modo de administración. La formulación particular también puede depender de si el scPV está vivo o inactivado. Los scPV purificados de la invención pueden liofilizarse para su uso posterior o pueden prepararse inmediatamente en una solución farmacéutica. Los scPV también pueden diluirse en una solución fisiológicamente aceptable, como solución salina estéril, con o sin adyuvante o vehículo.

        Las formulaciones inmunogénicas (p. ej., vacunas) de la invención pueden administrarse a pacientes mediante escarificación. Las vacunas también pueden administrarse por cualquier otra vía estándar de administración. Pueden usarse muchos métodos para introducir las formulaciones inmunogénicas (p. ej., vacunas), que incluyen pero no se limitan a las vías intranasal, intratraqueal, oral, intradérmica, intramuscular, intraperitoneal, intravenosa, conjuntival y subcutánea. En las aves, los métodos pueden incluir además la inoculación coanal. Como alternativa a la administración parenteral, la invención también abarca vías de administración masiva para fines agrícolas, como a través del agua potable o en forma de aerosol. Alternativamente, puede ser preferible introducir un scPV de la invención a través de su ruta natural de infección. En algunas realizaciones, las formulaciones inmunogénicas de la invención se administran como un líquido inyectable, una planta transgénica consumible que expresa la vacuna, un gel de liberación sostenida o una composición encapsulada implantable, un implante sólido o un ácido nucleico. La formulación inmunogénica también se puede administrar en forma de crema, loción, ungüento, parche para la piel, pastilla o líquido oral tal como una suspensión, solución y emulsión (aceite en agua o agua en aceite).

        En ciertas realizaciones, una formulación inmunogénica de la invención (p. ej., vacuna) no da como resultado una protección completa contra una infección, pero da como resultado un título más bajo o un número reducido del patógeno (p. ej., poxvirus patógeno) en comparación con un sujeto no tratado. En ciertas realizaciones, la administración de las formulaciones inmunogénicas de la invención da como resultado un aumento de 0,5 veces, 1 vez, 2 veces, 4 veces, 6 veces, 8 veces, 10 veces, 15 veces, 20 veces, 25 veces, 50 veces, 75 veces , 100 veces, 125 veces, 150 veces, 175 veces, 200 veces, 300 veces, 400 veces, 500 veces, 750 veces o 1.000 veces o más reducción en el título del patógeno en relación con un sujeto no tratado. Los beneficios de una reducción en el título, el número o la carga total de patógenos incluyen, entre otros,

        En ciertas realizaciones, una formulación inmunogénica de la invención (p. ej., una vacuna) no da como resultado una protección completa contra una infección, pero da como resultado un menor número de síntomas o una disminución de la intensidad de los síntomas, o una disminución de la morbilidad o una disminución de la mortalidad en comparación con un tema no tratado.

        En diversas realizaciones, las formulaciones inmunogénicas de la invención (p. ej., vacunas) o los anticuerpos generados por los scPV de la invención se administran a un sujeto en combinación con una o más terapias (p. ej., terapias antivirales o inmunomoduladoras) para la prevención de una infección (p. ej., una infección poxviral patógena). En otras realizaciones, las formulaciones inmunogénicas de la invención o los anticuerpos generados por los scPV de la invención se administran a un sujeto en combinación con una o más terapias (p. ej., terapias antivirales o inmunomoduladoras) para el tratamiento de una infección (p. ej., un infección poxviral patógena). En otras realizaciones más, las formulaciones inmunogénicas de la invención o los anticuerpos generados por los scPV de la invención se administran a un sujeto en combinación con una o más terapias (p. ej., terapias antivirales o inmunomoduladoras) para el control y/o la mejora de una infección (p. ej., un infección poxviral patógena). En una realización específica, las formulaciones inmunogénicas de la invención o los anticuerpos generados por los scPV de la invención se administran a un sujeto en combinación con una o más terapias (por ejemplo, terapias antivirales o inmunomoduladoras) para la prevención de la viruela. En otra realización específica, las formulaciones inmunogénicas de la invención o los anticuerpos generados por los scPV de la invención se administran a un sujeto en combinación con una o más terapias (p. ej., terapias antivirales o inmunomoduladoras) para el tratamiento de la viruela. En algunas realizaciones, la vacuna puede usarse en combinación con uno o más tratamientos antivirales para suprimir la replicación viral. En algunas realizaciones, la vacuna se puede usar en combinación con el tratamiento con brincidofovir para suprimir la replicación viral. En algunas realizaciones, la vacuna se puede usar en combinación con el tratamiento con tecovirimat/SIGA-246 para suprimir la replicación viral. En algunas realizaciones, la vacuna se puede usar en combinación con fosfonatos de nucleósidos acíclicos (cidofovir), profármacos alcoxialquilo orales de nucleósidos acíclicos o fosfonatos (brincidofovir o CMX001). En algunas realizaciones, la vacuna se puede usar en combinación con inmunoglobulina vaccinia (VIG). En algunas realizaciones, la vacuna puede usarse en sujetos que han sido inmunizados previamente con antígenos peptídicos o proteicos derivados de VACV, VARV o HPXV. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con VVAC muertos o inactivados. En algunas realizaciones, la vacuna se puede usar en sujetos que han sido inmunizados previamente con la cepa del virus VACV de replicación deficiente/defectuosa, MVA (virus modificado de Ankara).

        CONTINUA EN EL SIGUIENTE POST ————————————————————————————➤

        1. Zack Saetonious

          En las formulaciones (p. ej., formulaciones de vacunas) y los métodos de la invención se puede usar cualquier agente antiviral bien conocido por un experto en la técnica. Los ejemplos no limitantes de agentes antivirales incluyen proteínas, polipéptidos, péptidos, proteínas de fusión, anticuerpos, moléculas de ácido nucleico, moléculas orgánicas, moléculas inorgánicas y moléculas pequeñas que inhiben y/o reducen la unión de un virus a su receptor, la internalización de un virus en una célula, la replicación de un virus o la liberación de virus de una célula. En particular, los agentes antivirales incluyen, entre otros, antivirales que bloquean la maduración extracelular del virus (tecovirimat/SIGA-246), fosfonatos de nucleósidos acíclicos (cidofovir), profármacos alcoxialquilo orales de fosfonatos de nucleósidos acíclicos (brincidofovir o CMX001) o inmunoglobulina vacunal. (VIG). En algunas realizaciones,

          Las dosis y los regímenes de dosificación pueden ser determinados por un experto en la técnica de acuerdo con las necesidades de un sujeto a tratar. El trabajador calificado puede tomar en consideración factores tales como la edad o el peso del sujeto, la gravedad de la enfermedad o condición que se está tratando y la respuesta del sujeto al tratamiento. Una composición de la invención se puede administrar, por ejemplo, según sea necesario o diariamente. La dosificación puede tener lugar durante períodos de tiempo variables. Por ejemplo, un régimen de dosificación puede durar 1 semana, 2 semanas, 3 semanas, 4 semanas, 5 semanas, 6 semanas, 7 semanas, 8 semanas, 9 semanas, 10 semanas, 11 semanas, 12 semanas o más. En algunas realizaciones, un régimen de dosificación durará 1 mes, 2 meses, 3 meses, 4 meses, 5 meses, 6 meses, 7 meses, 8 meses, 9 meses, 10 meses, 11 meses, 12 meses o más.

          Los scPV de la invención también pueden usarse para producir anticuerpos útiles para inmunoterapia pasiva, inmunoensayos de diagnóstico o pronóstico, etc. Los métodos para producir anticuerpos son bien conocidos en la técnica. Los anticuerpos pueden modificarse adicionalmente (p. ej., quimerización, humanización, etc.) antes de su uso en inmunoterapia.

          Agentes oncolíticos
          Los poxvirus quiméricos sintéticos (scPV) de la invención se pueden usar como agentes oncolíticos que se replican selectivamente en las células cancerosas y las destruyen. Las células que se dividen rápidamente, como las células cancerosas, generalmente son más permisivas para la infección poxviral que las células que no se dividen. Muchas características de los poxvirus, como la seguridad en humanos, la facilidad de producción de stocks de alto título, la estabilidad de las preparaciones virales y la capacidad de inducir inmunidad antitumoral después de la replicación en células tumorales, hacen que los poxvirus sean agentes oncolíticos deseables. Los scPV producidos según los métodos de la invención pueden comprender una o modificaciones que los hacen adecuados para el tratamiento del cáncer. En consecuencia, en un aspecto, la descripción proporciona un método para inducir la muerte en células cancerosas, comprendiendo el método poner en contacto las células con un scPV aislado o una composición farmacéutica que comprende un scPV de la invención. En un aspecto, la descripción proporciona un método para tratar el cáncer, comprendiendo el método administrar a un paciente que lo necesite, una cantidad terapéuticamente eficaz de un scPV de la invención. Otro aspecto incluye el uso de un scPV o una composición descrita en el presente documento para inducir la muerte en una célula con un trastorno neoplásico como una célula cancerosa o para tratar un trastorno neoplásico como el cáncer. En algunas realizaciones, la terapia oncolítica con poxvirus se administra en combinación con una o más terapias convencionales contra el cáncer (p. ej., cirugía, quimioterapia, radioterapia, termoterapia y terapia biológica/inmunológica). En realizaciones específicas, el virus oncolítico es un VVAC quimérico sintético (scVACV) de esta invención. En algunas realizaciones, el virus oncotísico es un virus de mixoma quimérico sintético de esta invención. En algunas realizaciones, el virus oncolítico es un HPXV quimérico sintético (scHPXV) de esta invención. En algunas realizaciones, el virus oncolítico es un virus de la viruela del mapache quimérico sintético de esta invención. En algunas realizaciones, el virus oncolítico es un virus de enfermedad similar a yaba quimérico sintético de esta invención.

          Usando los métodos de esta invención, uno o más genes deseables pueden introducirse fácilmente y uno o más genes indeseables pueden eliminarse fácilmente del genoma poxviral quimérico sintético. En algunas realizaciones, los scPV de la invención para uso como agentes oncolíticos están diseñados para expresar transgenes para mejorar su inmunorreactividad, direccionamiento antitumoral y/o potencia, propagación de célula a célula y/o especificidad de cáncer. En algunas realizaciones, un scPV de la invención se diseña o manipula para expresar un gen inmunomodulador (p. ej., GM-CSF o un gen viral que bloquea la función TNF). En algunas realizaciones, un scPV de la invención está diseñado para incluir un gen que expresa un factor que atenúa la virulencia. En algunas realizaciones, un scPV de la invención se diseña o manipula para expresar un agente terapéutico (p. ej., hEPO, BMP-4, anticuerpos contra antígenos tumorales específicos o porciones de los mismos, etc.). En algunas realizaciones, los scPV de la invención se han modificado para la atenuación. En algunas realizaciones, el scPV de la invención se diseña o manipula para que carezca del gen viral TK. En algunas realizaciones, un scVACV de la invención se diseña o manipula para que carezca del gen del factor de crecimiento de vaccinia. En algunas realizaciones, un scVACV de la invención se diseña o fabrica para que carezca del gen de la hemaglutinina.

          Los scPV de la invención son útiles para tratar una variedad de trastornos neoplásicos y/o cánceres. En algunas realizaciones, el tipo de cáncer incluye, entre otros, cáncer de hueso, cáncer de mama, cáncer de vejiga, cáncer de cuello uterino, cáncer colorrectal, cáncer de esófago, gliomas, cáncer gástrico, cáncer gastrointestinal, cáncer de cabeza y cuello, cáncer hepático tal como cáncer hepatocelular. carcinoma, leucemia, cáncer de pulmón, linfomas, cáncer de ovario, cáncer de páncreas, cáncer de próstata, cáncer renal, cáncer de piel como el melanoma, cáncer de testículo, etc. o cualquier otro tumor o lesión preneoplásica que pueda tratarse.

          En otra realización, el método comprende además detectar la presencia del scPV administrado, en el trastorno neoplásico o célula cancerosa y/o en una muestra de un sujeto al que se administró un virus aislado o recombinante o una composición descrita en el presente documento. Por ejemplo, el sujeto puede analizarse antes de la administración y/o después de la administración del scPV o la composición descrita en el presente documento para evaluar, por ejemplo, la progresión de la infección. En algunas realizaciones, un scPV de la divulgación comprende un casete de detección y detectar la presencia del poxvirus quimérico administrado comprende detectar la proteína codificada por el casete de detección. Por ejemplo, cuando el casete de detección codifica una proteína fluorescente, se obtienen imágenes del sujeto o de la muestra usando un método para visualizar la fluorescencia.

          Las formulaciones oncolíticas de la presente invención comprenden una cantidad eficaz de un scPV de la invención y un vehículo farmacéuticamente aceptable. El término «farmacéuticamente aceptable» significa aprobado por una agencia reguladora del gobierno federal o estatal o enumerado en la Farmacopea de EE. UU. u otras farmacopeas generalmente reconocidas para uso en animales, y más particularmente en humanos. El término «vehículo» se refiere a un diluyente, adyuvante, excipiente o vehículo con el que se administra la composición farmacéutica (p. ej., formulación oncolítica). Las soluciones salinas y las soluciones acuosas de dextrosa y glicerol también se pueden emplear como vehículos líquidos, particularmente para soluciones inyectables. Los excipientes adecuados incluyen almidón, glucosa, lactosa, sacarosa, gelatina, malta, arroz, harina, tiza, gel de sílice, estearato de sodio, monoestearato de glicerol, talco, cloruro de sodio, leche descremada en polvo, glicerol, propileno, glicol, agua, etanol y similares. Los ejemplos de vehículos farmacéuticos adecuados se describen en «Remington’s Pharmaceutical Sciences» de EW Martin. La formulación debe adaptarse al modo de administración.

          Vectores virales para expresión génica recombinante
          Los poxvirus quiméricos sintéticos (scPV) de la invención pueden diseñarse para llevar secuencias heterólogas. Las secuencias heterólogas pueden ser de una especie de poxvirus diferente o de cualquier fuente no poxviral. En un aspecto, las secuencias heterólogas son epítopos antigénicos que se seleccionan de cualquier fuente no poxviral. En algunas realizaciones, el virus recombinante puede expresar uno o más epítopos antigénicos de una fuente no poxviral que incluye, entre otros , Plasmodium falciparum , micobacterias, Bacillus anthracis, Vibrio cholerae., MRSA, rabdovirus, virus de la gripe, virus de la familia de los flavivirus, paramixovirus, virus de la hepatitis, virus de la inmunodeficiencia humana, o de virus que provocan fiebre hemorrágica, tales como hantavirus o filovirus, es decir, ébola o marburg virus. En otro aspecto, las secuencias heterólogas son epítopos antigénicos de una especie de poxvirus diferente. Estas secuencias virales pueden usarse para modificar el espectro del huésped o la inmunogenicidad del scPV.

          En algunas realizaciones, un scPV de la invención puede codificar un gen/ácido nucleico heterólogo que expresa un ácido nucleico terapéutico (p. ej., ácido nucleico antisentido) o un péptido terapéutico (p. ej., péptido o proteína con una actividad biológica deseada).

          En algunas realizaciones, la expresión de una secuencia de ácido nucleico heterólogo está preferentemente, pero no exclusivamente, bajo el control transcripcional de un promotor de poxvirus. En algunas realizaciones, la secuencia de ácido nucleico heteróloga se inserta preferiblemente en una región no esencial del genoma del virus. Los métodos para insertar secuencias heterólogas en el genoma poxviral son conocidos por un experto en la técnica. En algunas realizaciones, el ácido nucleico heterólogo se introduce mediante síntesis química. En una realización ejemplar, se puede clonar un ácido nucleico heterólogo en el locus HPXV095/J2R o HPXV044 de un scHPXV de la invención.

          Un scPV de la presente invención puede usarse para la introducción de una secuencia de ácido nucleico heteróloga en una célula diana, siendo la secuencia homóloga o heteróloga a la célula diana. La introducción de una secuencia de ácido nucleico heteróloga en una célula diana puede usarse para producir péptidos o polipéptidos heterólogos in vitro y/o virus completos codificados por la secuencia. Este método comprende la infección de una célula huésped con el scPV; cultivo de la célula huésped infectada en condiciones adecuadas; y aislamiento y/o enriquecimiento del péptido, proteína y/o virus producido por la célula huésped.

          Debe entenderse que las realizaciones de la presente invención que se han descrito son meramente ilustrativas de algunas de las aplicaciones de los principios de la presente invención. Los expertos en la técnica pueden realizar numerosas modificaciones basándose en las enseñanzas presentadas en este documento sin apartarse del verdadero espíritu y alcance de la invención.

          Los siguientes ejemplos se exponen como representativos de la presente invención. Estos ejemplos no deben interpretarse como limitantes del alcance de la invención ya que estas y otras realizaciones equivalentes serán evidentes a la vista de la presente descripción, las figuras y las realizaciones adjuntas.

          EJEMPLOS
          Ejemplo 1. Selección y diseño de fragmentos superpuestos del genoma viral
          Materiales y métodos
          Diseño de genoma quimérico sintético HPXV (scHPXV)

          El diseño del genoma de scHPXV se basa en la secuencia del genoma descrita anteriormente para HPXV (cepa MNR-76; HIGO. 1A ) [acceso a GenBank DQ792504] (Tulman ER, Delhon G, Afonso CL, Lu Z, Zsak L, Sandybaev NT, et al. Genome of horsepox virus. Journal of Virology. 2006; 80(18):9244-58). El genoma de 212.633 pb se divide en 10 fragmentos superpuestos ( HIGO. 1B ). Estos fragmentos se diseñaron para que compartieran al menos 1,0 kpb de secuencia superpuesta (es decir, homología) con cada fragmento adyacente, para proporcionar sitios donde la recombinación homóloga impulsará el ensamblaje de genomas completos (Tabla 1). Estas secuencias superpuestas proporcionarán suficiente homología para llevar a cabo con precisión la recombinación entre los fragmentos cotransfectados (Yao XD, Evans D H. High-frequency genetic recombination and reactivation of orthopoxviruses from DNA fragments transfected into leporipoxvirus-infected cells. Journal of Virology. 2003 ; 77(13):7281-90). Es posible que las superposiciones más cortas o más largas sirvan para un propósito similar. Los 40 pb terminales de la secuencia del genoma de HPXV (5′-TTTATTAAATTTTACTATTTATTTAGTGTCTAGAAAAAAA-3′) (SEQ ID NO: 59) no están incluidos en los fragmentos de repetición terminal invertida (ITR) sintetizados. En su lugar, se agrega un sitio de restricción SapI en el extremo 5′ (GA_LITR) y el extremo 3′ (GA_RITR) de los fragmentos ITR seguido de una secuencia TGT. Estos sitios de restricción de SapI se usan para ligar las horquillas terminales de VACV en los fragmentos de ITR (descritos a continuación).

          Cada fragmento se sintetiza químicamente y se subclona en un plásmido usando sitios de restricción SfiI terminales en cada fragmento. Para ayudar con la subclonación de estos fragmentos, los sitios de restricción AarI y BsaI se mutan silenciosamente en todos los fragmentos, excepto en los dos fragmentos que codifican ITR (Tabla 2). Los sitios de restricción BsaI en los dos fragmentos que codifican ITR no están mutados, en caso de que estas regiones contengan sitios de reconocimiento específicos de secuencias de nucleótidos que son importantes para la replicación eficiente del ADN y la resolución del concatámero.

          Se introduce un casete de yfp/gpt bajo el control de un promotor tardío temprano de poxvirus en el locus HPXV095/J2R dentro de GA_Fragment_3) para que la reactivación de HPXV (scHPXV YFP-gpt::095) sea fácil de visualizar bajo un microscopio de fluorescencia. El locus gpt también proporciona una herramienta potencial para seleccionar virus reactivados mediante la selección de fármacos. HPXV095 codifica el homólogo de HPXV del gen J2R no esencial de VACV y al cotransfectar Fragment_3 y otros clones de HPXV en células BGMK infectadas con SFV, junto con el ADN de VACV, se recupera una variedad de virus híbridos, lo que valida la estrategia de selección ( FIGURAS. 13A y 13B ). También se introducen mutaciones silenciosas en la secuencia HPXV044 (VACV WR F4L) (GA_Fragment_2) para crear dos sitios de restricción únicos dentro de GA_Fragment_2 (Tabla 3). En algunas realizaciones, estos sitios de restricción únicos pueden usarse para introducir rápidamente productos génicos recombinantes (tales como, entre otros, marcadores seleccionables, proteínas fluorescentes, antígenos, etc.) en GA_Fragment_2 antes de la reactivación de HPXV.

          TABLA 1 Los fragmentos del genoma HPXV utilizados en este estudio. El tamaño de cada se indican el fragmento y la ubicación dentro del genoma del HPXV. Ubicación dentro HPXV [DQ792504] Nombre del fragmento Tamaño (pb) (pb) GA_Left ITR (SEQ ID NO: 1) 10,095    41-10,135 GA_Fragmento 1A (SEQ ID NO: 2) 16,257  8505-24,761 GA_Fragmento 1B (SEQ ID NO: 3) 16,287  23764-40,050 GA_Fragmento 2 (SEQ ID NO: 4) 31,946 38,705-70,650 GA_Fragmento 3 (SEQ ID NO: 5) 25,566 68,608-94,173 GA_Fragmento 4 (SEQ ID NO: 6) 28,662  92,587-121,248 GA_Fragmento 5 (SEQ ID NO: 7) 30,252 119,577-149,828 GA_Fragmento 6 (SEQ ID NO: 8) 30,000 147,651-177,650 GA_Fragmento 7 (SEQ ID NO: 9) 28,754 176,412-205,165 GA_Right ITR (SEQ ID NO: 10) 8,484 204,110-212,593

          TABLA 2 Mutaciones silenciosas creadas en fragmentos scHPXV YFP-gpt::095 para eliminar los sitios de restricción AarI y BsaI del genoma de HPXV. nucleótido cambiar en Mutación Restricción codificación Localización verificada por endonucleasa hilo de en HPXV todo GA_HPXV reconocimiento HPXV HPXV genoma genoma Fragmento sitio eliminado genoma Gene [DQ792504] secuenciación GA_Frag_1A BsaI A a G HPXV011a 11,228 ✓ GA_Frag_1B BsaI A a G HPXV025 27,845 ✓ GA_Frag_2 BsaI A a G HPXV040 41,232 ✓ BsaI G a A HPXV059 56,775 ✓ BsaI G a A HPXV066 67,836 ✓ GA_Frag_3 BsaI G a A HPXV083 84,361 ✓ AarI T a C HPXV091 89,368 ✓ GA_Frag_4 BsaI T a C HPXV099 96,239 ✓ BsaI A a G HPXV099 96,437 ✓ BsaI A a G HPXV110 109,492 ✓ BsaI A a G HPXV111 110,661 ✓ BsaI G a A HPXV111 110,840 ✓ GA_Frag_4 BsaI C a T HPXV119 120,933 ✓ GA_Frag_5 GA_Frag_5 BsaI A a G HPXV123 123,035 ✓ BsaI T a C HPXV145 144,834 ✓ GA_Frag_5 BsaI T a C HPXV146d 149,727 ✓ GA_Frag_6 GA_Frag_6 BsaI G a A HPXV178b 175,070 ✓ GA_Frag_7 BsaI G a A HPXV182 180,573 ✓ BsaI A a G HPXV192 187,476 ✓ AarI G a A HPXV193 188,761 ✓ BsaI C a T HPXV197 195,680 ✓ AarI T a C HPXV200 199,873 ✓

          TABLA 3 Introducción de mutaciones nucleótidas silenciosas en el HPXV044 (VACV F4L) para crear sitios de endonucleasas de restricción únicos en GA_Fragmento_2. Restricción Cambio de nucleótido endonucleasa en el HPXV Ubicación en gen HPXV sitio creado hebra de codificación genoma HPXV HPXV044 disponible A a C 44,512 estudié A a C 45,061

          Síntesis de las formas lenta (S) y rápida (F) de los bucles terminales en horquilla de VACV (Strain WR)
          Las formas Lenta (S) y Rápida (F) de los bucles en horquilla terminales de la VACV (cepa WR) se sintetizan como fragmentos de ssDNA de 157 nt (Integrated DNA Technologies; HIGO. 2B ). A través de la síntesis de ADN, se deja un saliente 5 ‘compuesto por tres nucleótidos al final de cada horquilla (5’-ACA; HIGO. 2C ). El sitio de resolución del concatámero de la secuencia HPXV [DQ792504] también se sintetiza en los bucles de horquilla terminales ( HIGO. 2B ).

          Digestión y purificación de fragmentos de scHPXV YFP-Gpt::095

          Los fragmentos sintéticos de HPXV se digieren con SfI durante la noche a 50 °C. Los fragmentos de scHPXV ITR se digieren individualmente con SapI (ThermoFisher Scientific) durante 1 h, se inactivan a 65 °C durante 10 minutos, antes de la digestión con SfiI durante la noche a 50 °C. Se añade aproximadamente 1 U de fosfatasa alcalina FastAP a las digestiones de scHPXV YFP-gpt::095 ITR y se incuba a 3TC durante 1 hora más. Todos los fragmentos de scHPXV YFP-gpt::095 se purifican posteriormente usando un kit de limpieza de ADN QiaexII (Qiagen). Todos los fragmentos scHPXV YFP-gpt::095 se eluyen de la suspensión QiaexII en Tris-HCl 10 mM. Las concentraciones de ADN se estiman utilizando un NanoDrop (ThermoFisher Scientific).

          Resultados
          Los poxvirus catalizan reacciones de recombinación homóloga de muy alta frecuencia que están inextricablemente vinculadas al proceso de replicación del virus. En este documento, se demuestra que los fragmentos grandes de ADN dúplex de HPXV sintetizados químicamente pueden unirse para formar un genoma funcional de scHPXV utilizando reacciones de replicación y recombinación catalizadas por virus.

          Utilizando la secuencia publicada del genoma HPXV (cepa WNR-76), el genoma de 212 633 pb se divide en 10 fragmentos superpuestos ( HIGO. 2 ). Todos los sitios BsaI y AarI en cada fragmento excepto los ITR están mutados, en caso de que los sitios específicos de secuencia dentro de esta región se requieran sin saberlo para la replicación eficiente del genoma y la resolución del concatámero. Como se describió anteriormente, para facilitar la adición de las estructuras de bucle de horquilla terminal de VACV en el extremo de los ITR, se incluye un sitio de reconocimiento de SapI junto al extremo terminal izquierdo y derecho de los fragmentos LITR y RITR, respectivamente ( HIGO. 2A ). Estos sitios SapI están incrustados dentro de las secuencias del vector flanqueante, y la enzima SapI corta aguas abajo del sitio, fuera de la secuencia de reconocimiento y en el ADN de HPXV. Por lo tanto, cuando el ADN se corta con SapI, deja extremos adhesivos dentro del ADN copiado de la secuencia HPXV y, por lo tanto, permite el ensamblaje de una copia de secuencia precisa (a través de una ligadura posterior), que no contiene sitios de restricción extraños. Los otros extremos de los fragmentos LITR y RITR (los extremos internos con respecto al mapa del genoma) están delimitados por sitios de reconocimiento SfiI, al igual que ambos extremos de los fragmentos restantes de HPXV. Todos estos ADN se suministran en forma de plásmido para una fácil propagación. Para preparar los fragmentos internos para la transfección en células infectadas con SFV, estos plásmidos se digieren con SfiI para liberar el plásmido de cada scHPXV YFP-gpt: 095 (consulte a continuación cómo se procesan los fragmentos LITR y RITR). Después de la digestión, cada reacción se purifica para eliminar cualquier enzima contaminante, pero el plásmido no se elimina de la digestión y se cotransfecta junto con cada fragmento de scHPXV YFP-gpt::095. Esto no interfiere con la reacción y se hace para minimizar la cantidad de manipulación del ADN y la posible fragmentación de estos grandes fragmentos de ADN.

          Si bien la eficiencia de la reacción puede verse afectada por el número de fragmentos transfectados, en los métodos de la invención se pueden usar más o menos de 10 fragmentos superpuestos. Sin estar ligado a la teoría, los fragmentos ~15 pueden representar un límite superior práctico sin una mayor optimización de la reacción de reactivación. El límite inferior ideal sería un solo fragmento de genoma, pero en la práctica los telómeros se manipulan más fácilmente como fragmentos de tamaño más modesto (p. ej., ~10 kb).

          Ejemplo 2. Ligadura de bucles en horquilla terminales F y S de VACV en fragmentos de ITR izquierdo y derecho de scHPXV YFP-Gpt::095
          Materiales y métodos
          Ligadura de las formas S y F de los bucles terminales en horquilla en fragmentos scHPXV YFP-Gpt::095 ITR

          Se incuba aproximadamente un microgramo de cada uno de los bucles en horquilla terminales de la VACV a 95ºC durante 5 minutos, seguido de un enfriamiento rápido en hielo para formar la estructura en horquilla. Los bucles de horquilla se fosforilan posteriormente en su extremo 5 ‘antes de la ligadura. Brevemente, separe 20 μl de reacciones que contengan 1 μg de VACV F-hairpin o VACV S-hairpin, 2 μl de tampón de polinucleótido quinasa T4 10x (ThermoFisher Scientific), ATP 1 mM y 10 unidades de polinucleótido quinasa T4 (ThermoFisher Scientific) se incuban a 37°C durante 1 h. La reacción se termina por inactivación por calor a 75°C.

          Aproximadamente un microgramo de ITR izquierda o ITR derecha se incuba por separado con un exceso molar de 20 veces de cada horquilla terminal en presencia de PEG-4000 al 5 % y 5 unidades de ADN ligasa T4 durante la noche a 16 °C. Cada reacción de ligadura se inactiva con calor a 65ºC durante 10 minutos seguido de incubación en hielo hasta que esté listo para transfectarse en células.

          Resultados
          Los ortopoxvirus codifican genomas de dsDNA lineales que tienen repeticiones terminales invertidas (ITR) de longitud variable en cada extremo del genoma. Las dos hebras del genoma dúplex están conectadas por bucles de horquilla para formar una cadena de polinucleótidos covalentemente continua. Los bucles son ricos en A+T, no pueden formar una estructura completamente de pares de bases y existen en dos formas que son invertidas y de secuencia complementaria (Baroudy BM, Venkatesan S, Moss B). Los bucles terminales flip-flop emparejados de forma incompleta unen las dos cadenas de ADN del genoma del virus vaccinia en una cadena de polinucleótidos ininterrumpida. Celúla. mil novecientos ochenta y dos; 28(2):315-24) ( HIGO. 2B ). Se denominan formas lentas [S] y rápidas [F] en función de sus propiedades electroforéticas y probablemente se pliegan en estructuras de horquilla parcialmente dúplex que tapan los extremos del genoma lineal de dsDNA ( HIGO. 2C ). La secuencia publicada del genoma de HPXV está incompleta, probablemente le falten 60 pb en los extremos terminales, lo que hace imposible replicar con precisión las horquillas de HPXV. En su lugar, se sintetizaron químicamente fragmentos de ssDNA de 157 nt utilizando la secuencia publicada de los telómeros del VVAC como guía y dejando un saliente 5′ compuesto por tres nucleótidos al final de cada horquilla (5’-ACA; HIGO. 2C ) (Baroudy BM, Venkatesan S, Moss B). Los bucles terminales flip-flop emparejados de forma incompleta unen las dos cadenas de ADN del genoma del virus vaccinia en una cadena de polinucleótidos ininterrumpida. Celúla. mil novecientos ochenta y dos; 28(2):315-24). Este saliente es complementario a los extremos generados al cortar fragmentos LITR y RITR clonados con SapI.

          Las secuencias derivadas de VACV se utilizan en base a datos que sugieren una ascendencia común cercana entre HPXV y VACV. Puede ser posible usar otras horquillas terminales de otros poxvirus, ya que hay características de secuencia que se conservan comúnmente entre los extremos de horquilla de diferentes Chordopoxvirus. Por ejemplo, los sitios de resolución en los extremos de la horquilla están altamente conservados tanto en secuencia como en funcionalidad (se parecen a los promotores tardíos).

          Estos oligonucleótidos monocatenarios se calientan a 95 °C y luego se enfrían rápidamente en hielo para formar la horquilla terminal con pares de bases incompletas ( HIGO. 2C ). A continuación, cada oligonucleótido se fosforila y se liga por separado en un exceso molar de 20 veces con el fragmento ITR izquierdo o derecho previamente digerido tanto con SapI como con SfiI. La digestión de los ITR con estas enzimas da como resultado un saliente de 5′-TGT en los extremos 5′ de cada ITR, que era complementario al saliente de 5′-ACA en la estructura terminal del bucle en horquilla. Esto produce una copia terminada en horquilla de cada ITR.

          Para confirmar que se añade una estructura terminada en horquilla a ambos fragmentos de ITR, se realiza una digestión de restricción de los fragmentos de ITR con PvuII. Dado que es imposible visualizar la adición de una horquilla terminal de ~70 pb en el extremo de una ITR de ~10 kb mediante electroforesis en gel, se digiere una pequeña cantidad de cada ligadura con PvuII. Si no se liga ninguna horquilla terminal a la ITR, entonces la digestión con PvuII da como resultado un producto de 1472 pb ( FIGURAS. 3A y 3B , carriles 2 y 5). Sin embargo, si el bucle de horquilla terminal se agrega con éxito a las ITR de HPXV, entonces se observa un aumento en el tamaño del fragmento de ITR en un gel de agarosa ( HIGO. 3B , compare el carril 2 con el 3 y el 4; comparar carril 5 con 6 y 7). Estos datos sugieren que, en estas condiciones, casi todas las ITR de HPXV contienen bucles terminales en horquilla en un extremo del fragmento.

          Ejemplo 3. Reactivación de scHPXV YFP-Gpt::095 a partir de fragmentos de dsDNA sintetizados químicamente
          Materiales y métodos
          Virus y cultivo celular
          Las cepas SFV Kasza y BSC-40 se obtuvieron originalmente de la American Type Culture Collection. Se obtuvieron células de riñón de mono verde de búfalo (BGMK) de G. McFadden (Universidad de Florida). Las células BSC-40 y BGMK se propagan a 37 °C en CO2 al 5 % en medio mínimo esencial (MEM) suplementado con L-glutamina, aminoácidos no esenciales, piruvato de sodio, antibióticos y antimicóticos, y suero bovino fetal al 5 % (FCS ; ThermoFisher Scientific).

          Reactivación de scHPXV YFP-Gpt::095 en células infectadas por el virus del fibroma de Shope

          Se cultivan células de riñón de mono verde de búfalo (BGMK) en MEM que contiene placas de cultivo de tejidos de 60 mm hasta que alcanzan aproximadamente un 80% de confluencia. Las células se infectan con el virus del fibroma de Shope (SFV) en MEM sin suero a una MOI de 0,5 durante 1 h a 37 °C. El inóculo se reemplaza con 3 ml de MEM calentado que contiene FCS al 5% y se devuelve a la incubadora hora. Mientras tanto, las reacciones de transfección se establecen de la siguiente manera. Los complejos de lipofectamina se preparan mezclando aproximadamente 5 μg de fragmentos de ADN de HPXV sintéticos totales en 1 ml de Opti-MEM con Lipofectamine2000 diluido en 1 ml de Opti-MEM en una proporción de 3:1 (Lipofectamine2000 respecto al ADN total). En la Tabla 4 se muestra un ejemplo de cálculo para determinar la cantidad relativa de cada fragmento de HPXV. Los complejos se incuban a temperatura ambiente durante 10 minutos y luego se agregan gota a gota a las células BGMK previamente infectadas con SFV. Aproximadamente 16 h después de la infección, el medio se reemplaza con MEM fresco que contiene FCS al 5 %. Las células se cultivan durante 4 días adicionales (un total de 5 días) a 37 °C. Las partículas de virus se recuperaron raspando las células infectadas en el medio de cultivo celular y realizando tres ciclos de congelación y descongelación. El extracto crudo se diluye 10−2 en MEM sin suero y 4 ml del inóculo se sembraron en placas de cultivo de tejidos de 9-16 de 150 mm de células BSC-40 para recuperar scHPXV YFP-gpt::095 reactivado. Una hora después de la infección, el inóculo se reemplaza con MEM que contiene FCS al 5 % y agar noble al 0,9 %. Las placas fluorescentes amarillas se visualizan bajo un microscopio invertido y las placas individuales se seleccionan para su posterior análisis. Las placas de ScHPXV YFP-gpt::095 se purifican en placa tres veces con selección de fluorescencia amarilla.

          TABLA 4 Ejemplo de cálculo de la cantidad de cada GA_HPXV fragmento transfectado en células BGMK infectadas con SFV. Relación (frag. cantidad de ADN a fragmento longitud: genoma transfectar (ng) fragmento largo largo) ~1 mcg ~3 microgramos ~5 microgramos GA_LITR + F-horquilla 10,165 0.05 50 150 250 GA_LITR + S-horquilla 10,165 0.05 50 150 250 GA_Frag_1A 16,257 0.08 80 240 400 GA_Frag_1B 16,287 0.08 80 240 400 GA_Frag_2 31,946 0.15 150 450 750 GA_Frag_3 25,566 0.12 120 450 600 GA_Frag_4 28,662 0.13 130 390 650 GA_Frag_5 30,252 0.14 140 420 700 GA_Frag_6 30,000 0.14 140 420 700 GA_Frag_7 28,754 0.13 130 390 650 GA_RITR + F-horquilla 8,554 0.04 40 120 200 GA_RITR + S-horquilla 8,554 0.04 40 120 200
          Resultados
          La recombinación catalizada por SFV y la reactivación del ADN de orthopoxvirus para ensamblar virus vaccinia recombinantes se ha descrito anteriormente (Yao XD, Evans D H. High-frequency genetic recombination and reactivation of orthopoxviruses from DNA fragments transfected into leporipoxvirus-infected cells. Journal of Virology. 2003 , 77(13):7281-90, y Yao XD, Evans D H. Construction of recombinant vaccinia virus using leporipoxvirus-catalized recombination and reactivation of orthopoxvirus DNA. Methods Mol Biol. 2004; 269:51-64). Varias características biológicas hacen de este un sistema modelo atractivo. En primer lugar, el SFV tiene un rango de huéspedes estrecho, infectando productivamente células de conejo y ciertas líneas celulares de mono, como BGMK. Puede infectar, pero crece muy mal en células como BSC-40. En segundo lugar, crece más lentamente en comparación con los ortopoxvirus, tardando aproximadamente 4-5 días en formar “focos” transformados en monocapas de células, una característica que es muy diferente de los Orthopoxvirus, que producen placas en 1-2 días en cultivo. Esta diferencia en el crecimiento entre los Leporipoxvirus y los Orthopoxvirus permite diferenciar estos virus realizando los ensayos de reactivación en células BGMK y sembrando la progenie en células BSC-40. En algunas realizaciones, se pueden usar otros virus auxiliares (tales como, entre otros, el virus de la viruela aviar). En algunas realizaciones, pueden usarse diferentes combinaciones de células. Esta diferencia en el crecimiento entre los Leporipoxvirus y los Orthopoxvirus permite diferenciar estos virus realizando los ensayos de reactivación en células BGMK y sembrando la progenie en células BSC-40. En algunas realizaciones, se pueden usar otros virus auxiliares (tales como, entre otros, el virus de la viruela aviar). En algunas realizaciones, pueden usarse diferentes combinaciones de células. Esta diferencia en el crecimiento entre los Leporipoxvirus y los Orthopoxvirus permite diferenciar estos virus realizando los ensayos de reactivación en células BGMK y sembrando la progenie en células BSC-40. En algunas realizaciones, se pueden usar otros virus auxiliares (tales como, entre otros, el virus de la viruela aviar). En algunas realizaciones, pueden usarse diferentes combinaciones de células.

          Las células BGMK se infectan con SFV a una MOI de 0,5 y luego se transfectan con 5 μg de fragmentos GA_HPXV digeridos (Tabla 4) 2 h más tarde. Cinco días después de la transfección, todas las partículas infecciosas se recuperan mediante lisis celular y se vuelven a colocar en placas en células BSC-40, que solo soportan eficazmente el crecimiento de HPXV (u otros ortopoxvirus). Las placas de scHPXV YFP-gpt::095 reactivadas resultantes se visualizan bajo un microscopio de fluorescencia. La visualización está habilitada por el marcador seleccionable yfp/gpt en el locus HPXV095/J2R dentro de Frag_3 ( HIGO. 2A ). Las placas de virus se detectan en monocapas de BSC-40 dentro de las 48 h posteriores a la transfección. La eficiencia de recuperación de scHPXV YFP-gpt::095 depende de una serie de factores, incluida la eficiencia de transfección de ADN, pero varía hasta unas pocas PFU/μg de ADN transfectado.

          Ejemplo 4. Confirmación de la secuencia del genoma de scHPXV YFP-Gpt::095 mediante PCR y análisis de fragmentos de restricción
          Materiales y métodos
          PCR y análisis de digestión de restricción de scHPXV

          Para confirmar rápidamente la presencia de scHPXV YFP-gpt::095 en muestras de placas reactivadas, los cebadores de PCR están diseñados para flanquear los sitios BsaI individuales que fueron mutados en el scHPXV (Tabla 5). El ADN genómico de scHPXV YFP-gpt::095 se aísla de células BSC-40 infectadas con scHPXV YFP-gpt::095 y se utiliza como plantilla. El ADN genómico de las células BSC-40 infectadas con VVAC se usa como control para confirmar la presencia de sitios BsaI dentro de cada producto de PCR. Después de la amplificación por PCR, las reacciones se digieren posteriormente con BsaI durante 1 hora a 37 °C. Las reacciones de PCR se separan en un gel de agarosa al 1 % que contiene tinción segura SYBR® para visualizar las bandas de ADN.

          Se lleva a cabo un análisis adicional de los genomas de scHPXV YFP-gpt::095 mediante digestión de restricción seguida de electroforesis en gel de campo pulsado (PFGE) en ADN genómico aislado mediante purificación en gradiente de sacarosa (Yao XD, Evans D H. Construction of recombinant vacciniavirus using leporipoxvirus recombinación catalizada y reactivación de ADN de ortopoxvirus Methods Mol Biol. 2004; 269:51-64). Brevemente, se digieren 100 ng de ADN genómico viral purificado con 5 U de BsaI o HindIII durante 2 horas a 37 °C. El ADN digerido se analiza en un molde de gel de agarosa Seakem Gold al 1 % y se ejecuta en electroforesis con tris-borato-EDTA 0,5x. tampón (TBE) [tris 110 mM; borato 90 mM; EDTA 2,5 mM]. El ADN se resuelve en un aparato CHEF DR-III (BioRad) a 5,7 V/cm durante 9,5 ha 14 °C, utilizando un gradiente de tiempo de conmutación de 1 a 10 s, un factor de rampa lineal y un ángulo de 120 °. Este programa permite la resolución de especies de ADN desde 1 kbp hasta >200 kbp. Para resolver fragmentos de 75 pb a 5 kpb, se lleva a cabo una electroforesis en gel de agarosa al 1,5 % y se ejecuta en TBE 1,0x a 115 V durante 2 ha temperatura ambiente. El ADN se visualiza con tinción de oro SYBR®. El tamaño de los fragmentos de ADN de scHPXV YFP-gpt::095 digeridos se compara con el ADN genómico del VVAC de control.

          TABLA 5 Los cebadores que se utilizan en este estudio para amplificar regiones dentro de VACV y HPXV que rodea los sitios de restricción BsaI encontrados en GA_Fragment_1A, GA_Fragmento_1B, GA_Fragmento_2, GA_Fragmento_3, GA_Fragmento_4, GA_Fragmento_5, GA_Fragmento_6 y GA_Fragmento_7. Posición Posición de BsaI de BsaI sitio en sitio en VVAC [NC_ HPXV Primer nombre Secuencia de cebadores (5 a 3′) 6998] [DQ792504] HPXV 1A-FWD CTGTATACCCATACTGAATTGATG  16,756  27,849 (SEQ ID NO: 13) CAA HPXV 1A-REV GAGTTAATATAGACGACTTTACT (SEQ ID NO: 14) AAAGTCATG HPXV 1B-FWD GGTTCTTTTTATTCTTTTAAAACAG 23,076 N / A (SEQ ID NO: 15) ATCAATGG HPXV 1B-REV TTCTTATTAAGACATTGAGCCCAG (SEQ ID NÚM: 16) C HPXV 2A-FWD AGTCATCAATCATCATTTTTTCAC  30,073  41,225 (SEQ ID NÚM: 17) C HPXV 2A-REV (SEQ ID NO: 18) ATATAACGGACATTTCACCACC HPXV 2B-FWD GTAACATATACAACTTTTATTATG  45,485  56,778 (SEQ ID NO: 19) GCGTC HPXV 2B-REV CTAATCCACAAAAAATAGAATGT (SEQ ID NÚM: 20) TTAGTTATTTTG HPXV 2C-FWD AGTGACTGTTACCTCAAACATCC  56,576  67,839 (SEQ ID NO: 21) HPXV 2C-REV TTTATAAAGGGTTAACCTTTGTCA (SEQ ID NO: 22) CATC HPXV 3A-FWD TTGTGTAGCGCTTCTTTTTAGTC  60,981 N / A (SEQ ID NO: 23) HPXV 3A-REV AAACGGATCCATGGTAGAATATG (SEQ ID NO: 24) HPXV 3B-FWD TATTTGCATCTGCTGATAATCATC  84,916  84,353 (SEQ ID NO: 25) C HPXV 3B-REV CGATGGATTCAAATGACTTGTTA (SEQ ID NO: 26) ATG HPXV 4A-FWD ATGCCTTTACAGTGGATAAAGTT  85,101  96243 y (SEQ ID NO: 27) AAAC  96,428  HPXV 4A-REV CTGGATCCTTAGAGTCTGGAAG (SEQ ID NO: 28) HPXV 4B-FWD CGGAAAATGAAAAGGTACTAGAT  98,134 109,485 (SEQ ID NÚM: 29) ACG HPXV 4B-REV TGAATAGCCGTTAAATAATCTATT (SEQ ID NO: 30) TCGTC HPXV 4C-FWD TATGGATACATTGATAGCTATGA  99.302 y 110.653 y (SEQ ID NO: 31) AACG  99,481 110,832 HPXV 4C-REV AATACATCTGTTAAAATTGTTTGA (SEQ ID NO: 32) CCCG HPXV 5A-FWD CATTTTATTTCTAGACGTTGCCAG 111,686 123,037 (SEQ ID NO: 33) HPXV 5A-REV CGATATGAAACTTCAGGCGG (SEQ ID NO: 34) HPXV 5B-FWD ACAAAACGATTTAATTACAGAGT 122,484 N / A (SEQ ID NO: 35) TTTCAG HPXV 5B-REV GTCCGGTATGAGACGACAG (SEQ ID NO: 36) HPXV 5C-FWD TTAGGGATCACATGAATGAAATT 133,505, 144,838 (SEC ID Nº: 37) C.G. HPXV 5C-REV TATGGAAGTTCCGTTTCATCCG (SEQ ID NO: 38) HPXV 5D-FWD GACTTGATAATCATATATTAAAC 138,306 149,718 (SEC ID Nº: 39) ACATTGGATC HPXV 5D-REV AGATCTCCAGATTTCATAATATGA (SEQ ID NÚM: 40) TCAC HPXV 6A-FWD ATGATACGTACAATGATAATGAT 163,521 175,062 (SEC ID Nº: 41) ACAGTAC HPXV 6A-REV TGATTTTTGCAATTGTCAGTTAAC (SEC ID Nº: 42) ACAA HPXV 7A FWD TACTGTACCCACTATGAATAACG 169,035 180,578 (SEC ID Nº: 43) C HPXV 7A-REV GATATCAACATCCACTGAAGAAG (SEC ID Nº: 44) C.A. HPXV 7B-FWD ATCTTACCATGTCCTCAAATAAAT 175,849 187,467 (SEQ ID NO: 45) ACG HPXV 7B-REV ATAGCTCTAGGTATAGTCTGCAA (SEC ID Nº: 46) GRAMO HPXV 7C-FWD GCGAACTCCATTACACAAATATTT 181,952 195,683 (SEC ID Nº: 47) GRAMO HPXV 7D-REV GATGTTTTCTAAATATAGGTTCCGT (SEQ ID NO: 48) AGC
          Resultados
          La secuencia del genoma del virus aislado de placas cultivadas a partir del ensayo de reactivación se confirma mediante PCR, digestión de restricción y secuenciación del genoma completo. El análisis de PCR se basa en los sitios BsaI mutados dentro de todos los fragmentos excepto ITR HPXV. Los conjuntos de cebadores están diseñados para flanquear cada sitio BsaI en scHPXV YFP-gpt::095 (Tabla 5). Se confirma que estos conjuntos de cebadores también amplificarían una región similar dentro de VACV WR. Después de la amplificación por PCR de una región de aproximadamente 1 kb que rodea estos sitios BsaI mutados dentro de scHPXV YFP-gpt::095, cada reacción se digiere con BsaI y los fragmentos de ADN resultantes se analizan mediante electroforesis en gel. Dado que ningún sitio BsaI está mutado en el virus VACV (wt), la digestión enzimática digiere con éxito cada producto de PCR, lo que da como resultado un fragmento de ADN más pequeño ( HIGO. 4A , VVAC). Los productos de PCR generados a partir del ADN genómico de scHPXV YFP-gpt::095 son resistentes a la digestión con BsaI, lo que sugiere que el sitio de reconocimiento de BsaI está mutado con éxito en estos genomas ( HIGO. 4A , scHPXV YFP-gpt::095 (PP1) y scHPXV YFP-gpt::095 (PP3)). Los productos de cebadores para el conjunto de cebadores 7C no dieron como resultado ninguna amplificación de ADN en las muestras scHPXV YFP-gpt::095 PP1 y PP3. Para confirmar si este conjunto de cebadores no era funcional o si esta área del Fragmento 7 no se ensambló en el genoma scHPXV YFP-gpt::095 resultante, se realizó una PCR en el ADN del plásmido GA_Frag_7 original y esta reacción tampoco logró amplificar un producto.

          A continuación, se aísla el ADN genómico de los genomas de scHPXV YFP-gpt::095 purificados en gradiente de sacarosa, se digieren con BsaI o HindIII y se separan mediante electroforesis en gel de agarosa para confirmar que la mayoría de los sitios BsaI en scHPXV YFP-gpt::095 se procesan con éxito. mutado Curiosamente, el ADN genómico no digerido de 3 clones diferentes de scHPXV YFP-gpt::095 se ejecuta notablemente más lento en un gel en comparación con VACV, lo que confirma que el genoma de scHPXV YFP-gpt::095 (213 305 pb) es más grande que el de VACV-WR (194 711 pb) ( HIGO. 4B , compare los carriles 2-4 con el carril 5). Los clones de scHPXV YFP-gpt::095 son resistentes a la digestión con BsaI, lo que da como resultado un fragmento de ADN grande (~198000 pb) y un fragmento de ADN más pequeño de alrededor de 4000 pb después de la separación por PFGE ( HIGO. 4A , carril 7-9). Esto contrasta con el genoma de VACV-WR, que cuando se digiere con BsaI, conduce a la separación de una serie de fragmentos de ADN en el gel ( HIGO. 4B , carril 10). Dado que los tamaños de ADN esperados después de la digestión del genoma de scHPXV YFP-gpt::095 con BsaI son relativamente pequeños (Tabla 6), estos productos de digestión se separan mediante electroforesis en gel de agarosa convencional y se confirma que el scHPXV YFP-gpt::095 genera los fragmentos de tamaño apropiado ( HIGO. 4C , carriles 2-4). También se confirma que scHPXV YFP-gpt::095 produce el tamaño correcto de fragmentos de ADN después de la digestión con HindIII, lo que sugiere que estos reconocimientos se mantienen durante la síntesis de los fragmentos de ADN grandes (Tabla 6; HIGO. 4B , carriles 12-14; HIGO. 4C , carriles 6-8). En general, el análisis in vitro del genoma de scHPXV YFP-gpt::095 sugiere que la reactivación de HPXV a partir de fragmentos de ADN sintetizados químicamente es exitosa.

          TABLA 6 Tamaños esperados de fragmentos de ADN scHPXV YFP-gpt::095 digerido con BsaI o HindIII. scHPXV YFP- scHPXV YFP- Fragmento gpt::095 digerido gpt::095 digerido # con BsaI (pb) con HindIII (pb) 1 198,833 53,822 2 4046 24,848 3 4046 19,283 4 968 16,056 5 968 15,176 6 778 13,836 7 778 13,558 8 767 12,679 9 767 8877 10 391 8637 11 391 6493 12 138 5803 13 138 4631 14 64 4115 15 60 2216 dieciséis 54 1560 17 54 1442 18 32 273 19 32
          Dado que HPXV095 codifica el homólogo de HPXV del gen J2R no esencial de VACV, al cotransfectar Fragment_3 y otros clones de HPXV en células BGMK infectadas con SFV, junto con el ADN de VACV, se recupera una variedad de virus híbridos, lo que valida la estrategia de selección ( FIGURAS. 13A y 13B ). El primer virus híbrido (“VACV/HPXV+fragmento 3”) se obtiene mediante la cotransfección de ADN de VACV con HPXV Frag_3 ( HIGO. 1 ) en células infectadas con SFV. La inserción etiquetada en verde codifica el marcador de selección YFP-gpt. Los clones 1-3 se obtienen purificando el ADN de este primer genoma híbrido y transfectándolo de nuevo, junto con los fragmentos 2, 4, 5 y 7 de HPXV, en células infectadas con SFV. Los cebadores de PCR se diseñaron para dirigirse tanto a HPXV como a VACV (Tabla 5) y se utilizan para amplificar segmentos de ADN que abarcan los sitios BsaI que están mutados en los clones scHPXV. Después de la amplificación por PCR, los productos se digieren con BsaI para diferenciar las secuencias de VACV (que cortan) de HPXV (que no cortan). Los híbridos VACV/HPXV exhiben una combinación de sitios sensibles y resistentes a BsaI, mientras que el clon scHPXV YFP-gpt::095 reactivado es completamente resistente a BsaI.

          Ejemplo 5. Confirmación de la secuencia del genoma de scHPXV YFP-Gpt::095 mediante análisis de la secuencia del genoma completo
          Materiales y métodos
          Aislamiento y secuenciación de ADN de virus
          Se preparan stocks de clones HPXV YFP-gpt::095 (selección de placa [PP] 1.1, PP 2.1 y PP 3.1]) y se purifican sobre gradientes de sacarosa. Los ADN virales se extraen de cada preparación de virus purificada mediante digestión con proteinasa K seguida de extracción con fenol-cloroformo. La cantidad de dsDNA se determina utilizando un kit de ensayo Qubit dsDNA HS (ThermoFisher Scientific). Cada genoma viral se secuencia en el Molecular Biology Facility (MBSU) de la Universidad de Alberta. Las bibliotecas de secuenciación se generan utilizando el sistema Nextera Tagmentation (Epicentre Biotechnologies). Se cortan aproximadamente 50 ng de cada muestra y se prepara la biblioteca para la secuenciación final emparejada (2 × 300 pb) utilizando una plataforma Illumina MiSeq con una profundidad de lectura promedio de 3100 lecturas·nt −1 en todo el genoma y ˜190 lecturas·nt −1en las horquillas F y S.

          Montaje, análisis y anotación de secuencias
          Las lecturas de secuenciación sin procesar se recortan de las puntuaciones de secuencia de baja calidad y se asignan inicialmente a la secuencia de referencia de HPXV [GenBank Accession DQ792504] utilizando el software CLC Genomics Workbench 8.5. Todas las inserciones, eliminaciones y sustituciones de nucleótidos dentro de la secuencia scHPXV YFP-gpt::095 se verifican con la secuencia de referencia de HPXV. Genome Annotation Transfer Utility (GATU) (Tcherepanov V, Ehlers A, Upton C. Genome Annotation Transfer Utility (GATU): anotación rápida de genomas virales utilizando un genoma de referencia estrechamente relacionado. BMC Genomics. 2006; 7:150. Epub 2006/ 06/15) se utiliza para transferir la anotación de referencia a las secuencias del genoma de scHPXV.

          Resultados
          Los genomas de scHPXV YFP-gpt::095 purificados se secuencian utilizando un enfoque multiplex y un secuenciador Illumina MiSeq. Las lecturas de secuencia se asignan a las secuencias de referencia de HPXV de tipo salvaje (DQ792504) y scHPXV YFP-gpt::095 para confirmar la presencia de modificaciones específicas en el genoma de scHPXV YFP-gpt::095. Para confirmar que las secuencias repetidas terminales de VVAC están correctamente ligadas en el extremo terminal de la ITR izquierda, se analizan las lecturas de secuenciación en esta área del genoma. Se agrega una cadena de Cs al comienzo de la secuencia de referencia del genoma scHPXV YFP-gpt::095 para capturar todas las lecturas de secuencia que se asignan en esta región ( FIGURAS. 5A y 5B ). Esto se hace porque el programa utilizado para ensamblar las lecturas de secuencia truncará la visualización de secuencias en el punto donde termina la secuencia de referencia del genoma scHPXV YFP-gpt::095.

          Está claro a partir de las lecturas mapeadas que aunque el sitio de reconocimiento SapI está presente en el genoma de referencia scHPXV YFP-gpt::095, todas las lecturas de secuenciación carecen de esta secuencia. Esto confirma que el enfoque descrito en este documento produce una secuencia auténtica de HPXV en el sitio donde se ligó la horquilla sintética a los extremos de las ITR. También se obtiene con éxito la secuencia completa del bucle en horquilla terminal VACV WR, que resulta ser idéntica a la secuencia del ssDNA sintético que se liga a los extremos TIR. En general, estos datos sugieren que los bucles en horquilla terminales de VACV-WR se ligan con éxito en las secuencias ITR de HPXV y se recuperan en los virus infecciosos. Además, la distribución 1:1 de lecturas F y S en cada uno de los cinco virus sugirió que se requieren ambos extremos para producir un virus ( HIGO. 5B )

          A continuación, se verifica que cada sustitución de nucleótidos para mutar silenciosamente los sitios BsaI se ha incorporado correctamente al genoma de scHPXV YFP-gpt::095 ( HIGO. 6 ). Las lecturas de secuenciación se asignan a la secuencia de referencia HPXV (DQ792504). La cobertura general de lectura de secuenciación de Illumina en scHPXV YFP-gpt::095 de la región 96 050 a 96 500 se muestra en HIGO. 6A . Está claro a partir de aquí que hay dos conflictos en esta región que no se alinean correctamente con la referencia HPXV ( HIGO. 6A , líneas verticales azules y amarillas). Tras la ampliación de estas regiones, está claro que en la posición 96.239 hay una sustitución de T a C ( HIGO. 6B ) y en la posición 96,437 hay una sustitución de A a G ( HIGO. 6C ) en el genoma de scHPXV YFP-gpt::095. Se verificó que todas las sustituciones de nucleótidos que se introducen para mutar los sitios de reconocimiento BsaI y AarI seleccionados se crean en el genoma scHPXV YFP-gpt::095 (Tabla 2).

          Finalmente, se determina que las sustituciones de nucleótidos en HPXV044, diseñadas para crear sitios de restricción únicos en GA_Frag_2, también se incorporan al genoma de scHPXV YFP-gpt::095. La secuenciación lee ese mapa a HPXV044 (región 44,400 a 45,100) se muestra en HIGO. 7A . Dentro de esta región hay dos regiones donde las lecturas de secuenciación entran en conflicto con las de la secuencia en la secuencia de referencia HPXV YFP-gpt::095 ( HIGO. 7A , líneas verticales amarillas). Tras la ampliación de estas regiones, está claro que se introducen dos sustituciones T a G en la cadena no codificante de HPXV044 en las posiciones 44.512 y 45.061, creando así sitios de restricción AvaI y StuI en Frag_2 ( FIGURAS. 7B y 7C ). En general, los datos de secuenciación corroboran los datos del análisis genómico in vitro y confirman que scHPXV YFP-gpt::095 se reactiva con éxito en células infectadas con SFV.

          Ejemplo 6. ScHPXV YFP-Gpt::095 se replica más lentamente en células HeLa en comparación con otros poxvirus
          Materiales y métodos
          Los fibroblastos BSC-40, HeLa y HEL se obtuvieron originalmente de la American Type Culture Collection. Las células BSC-40 se propagan a 37 °C en CO2 al 5 % en medio mínimo esencial (MEM) suplementado con L-glutamina, aminoácidos no esenciales, piruvato de sodio, antibióticos y antimicóticos, y suero bovino fetal al 5 % (FCS; ThermoFisher Científico). Las células HeLa y HEL se propagan a 37ºC en CO2 al 5% en medio de Eagle modificado por Dulbecco suplementado con L-glutamina, antibióticos y antimicóticos y FCS al 10%.

          Resultados
          Las curvas de crecimiento de varios pasos y las mediciones del tamaño de la placa se utilizan para evaluar si scHPXV YFP-gpt::095 se replicó y propagó in vitro de manera similar a otros ortopoxvirus. Dado que no se dispone de un aislado natural de HPXV, el crecimiento de scHPXV YFP-gpt::095 se compara con el prototipo de poxvirus, VACV (cepa WR), Cowpox virus (CPX), un poxvirus estrechamente relacionado con HPXV y un clon de Dryvax virus, DPP15. Células epiteliales de riñón de mono (BSC-40), células Vero, una línea celular de carcinoma humano (HeLa) y células primarias de fibroblastos humanos (HEL) se infectan con VACV WR, CPX, DPP15 o scHPXV YFP-gpt::095 a una la MOI baja y las células infectadas se recolectan durante un transcurso de tiempo de 72 h. En las células BSC-40, la tasa de replicación y propagación del virus es comparable entre todos los virus probados ( HIGO. 8A ). Es importante destacar que scHPXV YFP-gpt::095 se replica tan bien como cualquiera de los otros poxvirus probados. El virus creció a títulos algo más bajos en células HEL y células Vero, y menos bien en células HeLa. En las células HeLa, se observa una disminución de hasta 1,5 log en la producción de virus en comparación con otros Orthopoxvirus.

          A continuación, se mide el tamaño de placa de scHPXV YFP-gpt::095 cultivado en células BSC-40. Una disminución estadísticamente significativa en el tamaño de la placa de scHPXV YFP-gpt::095 en comparación con VACV WR e incluso con el virus de la viruela vacuna ( HIGO. 8B ) es observado. Curiosamente, en las células BSC-40, scHPXV YFP-gpt::095 produce las placas más pequeñas en comparación con todos los demás ortopoxvirus probados ( HIGO. 8C ). Además, aunque diferentes cepas de VVAC producen virus extracelulares que forman placas secundarias más pequeñas, estos no son producidos por scHPXV YFP-gpt::095 ( HIGO. 8C ). En general, estos datos sugieren que la reactivación de scHPXV YFP-gpt::095 utilizando el sistema descrito en este documento no introduce ningún defecto evidente en la replicación del virus y la propagación in vitro en comparación con otros Orthopoxvirus. Además, el tamaño de la placa de scHPXV YFP-gpt::095 es similar al del virus de la viruela bovina (CPXV), lo que sugiere que la reactivación del virus sintético no tiene efectos nocivos sobre el fenotipo de placa pequeña que se ha observado previamente con otros virus similares al HPXV. clones (Medaglia ML, Moussatche N, Nitsche A, Dabrowski PW, Li Y, Damon IK, et al. Análisis genómico, fenotipo y virulencia de la cepa vacunal histórica contra la viruela brasileña IOC: Implicaciones para los orígenes y las relaciones evolutivas del virus vaccinia. Journal of Virology, 2015, 89(23):11909-25).

          Ejemplo 7. Eliminación del marcador de selección Yfp/Gpt
          Después de la reactivación de scHPXV YFP-gpt::095, se elimina el marcador de selección yfp/gpt en el locus HPXV095. Para ello, se sintetiza una región de secuencia de 1349 pb correspondiente a las posiciones nucleotídicas 91573 a 92921 en HPXV (DQ792504) (ThermoFisher Scientific) (SEQ ID NO: 60). Este fragmento incluía aproximadamente 400 pb de homología que flanqueaban ambos lados del gen wt HPXV095/J2R. Esta secuencia de ADN se clona en un vector comercial proporcionado por GeneArt. Para reemplazar el casete yfp/gpt con la secuencia del gen HPXV095, las células BSC-40 se infectan con scHPXV YFP-gpt::095 a una MOI de 0,5 y luego se transfectan, 2 h más tarde, con 2 μg de plásmido linealizado que contiene la secuencia wtHPXV095 utilizando Lipofectamine 2000 (ThermoFisher Scientific). Los virus recombinantes se recolectan 48 h después de la infección y los virus recombinantes (scHPXV (wt)) se aíslan utilizando tres rondas de purificación de placas no fluorescentes en agar. La PCR se usa para confirmar la identidad del scHPXV (wt) usando cebadores que flanquean el locus del gen HPXV095. Los cebadores utilizados para confirmar el reemplazo correcto del gen HPXV095 son HPXV095_check-FWD 5′-CCTATTAGATACATAGATCCTCGTCG-3′ (SEQ ID NO: 61) y HPXV095_check-REV 5′-CGGTTTATCTAACGACACAACATC-3′ (SEQ ID NO: 62).

          CONTINUA EN EL SIGUIENTE POST ————————————————————————————➤

          1. Zack Saetonious

            Ejemplo 8. Propiedades de crecimiento de scHPXV (Wt) frente a scHPXV YFP-Gpt::095
            En experimentos realizados como se describe anteriormente en el Ejemplo 6, scHPXV (wt) muestra propiedades de crecimiento no significativamente diferentes de scHPXV YFP-gpt::095 in vitro ( HIGO. 14A-C ). Se observa una disminución estadísticamente significativa en el tamaño de la placa de scHPXV (wt) en comparación con VACV WR ( HIGO. 14A ). scHPXV (wt), como scHPXV YFP-gpt::095, no produce virus extracelulares ( HIGO. 14B ) y no hay diferencias significativas en el crecimiento de scHPXV (wt) y scHPXV YFP-gpt::095 en células BSC-40, células HEL, células HeLA y células Vero ( HIGO. 14C ). El hallazgo de que scHPXV (wt) no produce virus extracelulares es relevante dado que esta propiedad afecta la virulencia.

            Ejemplo 9. Determinación de la Virulencia de scHPXV (Wt) en un Modelo Intranasal Murino
            Los efectos de toxicidad de scHPXV (wt) se determinan en este estudio. Para este experimento, a 6 grupos de ratones Balb/c se les administran 3 dosis diferentes de scHPXV (ΔHPXV_095/J2R) o scHPXV (wt) descritos en los Ejemplos 1-7 y se comparan con un grupo de control de PBS, así como con un control de VACV (WR). grupo y un grupo de control VACV (Dryvax cepa DPP15) (9 grupos de tratamiento en total). Hay 3 ratones adicionales incluidos en este experimento que no reciben ningún tratamiento durante la duración del estudio. Se toman muestras de sangre de todos los ratones en puntos predeterminados a lo largo del experimento y los ratones adicionales sirven como referencia para el análisis del suero.

            Antes de la inoculación de los ratones Balb/c, todas las cepas de virus se cultivan en células BSC-40 (riñón de mono verde africano), se recolectan mediante tripsinización, se lavan en PBS, se extraen de las células mediante homogeneización de rebote, se purifican a través de un colchón de sacarosa al 36 % mediante ultracentrifugación. , resuspendido en PBS, y titulado de manera que las concentraciones finales sean: 1) VACV (WR) – 5×10 5 PFU/ml; 2) VACV (DPP15)—109 UFP/ml; 3) scHPXV (ΔHPXV_095/J2R)—10 7 UFP/ml, 10 8 UFP/ml y 10 9 UFP/ml y 4) scHPXV (wt)—10 7 UFP/ml, 10 8 UFP/ml y 10 9 UFP/ml.

            Las dosis de scHPXV elegidas para este estudio (10 5 UFP/dosis, 10 6 UFP/dosis y 10 7 UFP/dosis) se basan en estudios previos que utilizaron cepas vacunales conocidas de VVAC, incluidas Dryvax e IOC (Medaglia ML, Moussatche N, Nitsche A, Dabrowski PW, Li Y, Damon IK, et al. Análisis genómico, fenotipo y virulencia de la cepa vacunal histórica contra la viruela brasileña IOC: Implicaciones para los orígenes y las relaciones evolutivas del virus vaccinia. Journal of Virology. 2015; 89( 23): 11909-25; Qin L, Favis N, Famulski J, Evans D H. Evolución y relaciones evolutivas entre cepas existentes del virus vaccinia. Journal of Virology. 2015; 89(3):1809-24).

            Dado que la pérdida de peso se utiliza como medida de virulencia en ratones, se administra VACV (cepa WR) por vía intranasal a una dosis de 5 x 10 3 PFU, lo que conduce a una pérdida de peso de aproximadamente un 20-30 %. El clon VACV Dryvax, DPP15, también se administra por vía intranasal a 10 7 PFU/dosis, de modo que la virulencia de esta conocida vacuna contra la viruela puede compararse directamente con scHPXV (wt). Los ratones se compran en Charles River Laboratories y, una vez recibidos, se aclimatan a su entorno durante al menos una semana antes de la administración del virus.

            Cada ratón recibe una dosis única de virus (~10 ul) administrada mediante inyección intranasal mientras está bajo anestesia. Los ratones se monitorean para detectar signos de infección, como hinchazón, secreción u otras anomalías todos los días durante un período de 30 días. Cada ratón se controla específicamente para la pérdida de peso todos los días después de la administración del virus. Los ratones que pierden más del 25 % de su peso corporal, además de otros factores de morbilidad, se someten a eutanasia de acuerdo con los protocolos de nuestro centro de salud animal en la Universidad de Alberta.

            Incluso con las dosis más altas de scHPXV probadas, es posible que no haya signos evidentes de enfermedad en los ratones Balb/c. Las cepas de VVAC más estrechamente relacionadas con scHPXV, antiguos virus sudamericanos, en algunos casos no produjeron enfermedad a 10 7 PFU (Medaglia ML, Moussatche N, Nitsche A, Dabrowski PW, Li Y, Damon IK, et al. Genomic Analysis, Phenotype , y Virulencia de la cepa vacunal histórica contra la viruela brasileña IOC: Implicaciones para los orígenes y las relaciones evolutivas del virus vaccinia. Journal of Virology. 2015; 89(23):11909-25). No es práctico probar dosis mucho más altas que esta debido a la dificultad de preparar soluciones madre purificadas con títulos superiores a 10 9 PFU/mL.

            Ejemplo 10. Determinación de si scHPXV confiere protección inmunitaria contra un desafío letal de VACV-WR
            Los ratones que parecen no verse afectados por la administración inicial del virus descrita en el Ejemplo 9 continúan aumentando de peso normalmente durante todo el experimento. Treinta días después de la inoculación del virus, los ratones se exponen posteriormente a una dosis letal de VACV-WR (10 6UFP/dosis) mediante inoculación intranasal. Los ratones se controlan de cerca en busca de signos de infección como se describe anteriormente. Los ratones se pesan diariamente y los ratones que pierden más del 25% de su peso corporal además de otros factores de morbilidad se someten a eutanasia. Esperamos que los ratones inoculados con PBS antes de la administración de una dosis letal de VACV-WR muestren signos de pérdida de peso significativa y otros factores de morbilidad dentro de los 7 a 10 días posteriores a la inoculación. Aproximadamente 14 días después de la exposición letal con VACV-WR, todos los ratones se sacrifican y se extrae sangre para confirmar la presencia de anticuerpos neutralizantes específicos de VACV en el suero mediante ensayos estándar de reducción de placa.

            Ejemplo 11. Construcción de un VCV quimérico sintético (cepa ACAM2000) (scACAM2000) usando reacciones de reactivación y recombinación catalizadas por SFV
            Diseño de fragmentos superpuestos del genoma de VACV (ACAM2000)
            Utilizando la secuencia publicada del genoma del VVAC (cepa ACAM2000; Acceso a Genbank AY313847), el genoma se divide en 9 fragmentos superpuestos ( HIGO. 9 ) que varían en tamaño desde 15 979 pb hasta 28 795 pb de longitud (Tabla 7). Estos fragmentos están diseñados para que compartan al menos 1,0 kpb de homología de secuencia superpuesta con cada fragmento adyacente para proporcionar sitios donde la recombinación homóloga pueda impulsar el ensamblaje de genomas completos (Tabla 7). Estos solapamientos deberían ser suficientes para permitir una recombinación precisa y eficaz entre los fragmentos cotransfectados.

            Para sintetizar y subclonar con éxito estos fragmentos grandes, cada sitio BsaI y AarI en los fragmentos 1 a 7 de VACV_ACAM2000 se mutan silenciosamente. Al igual que con la creación de scHPXV, los sitios de restricción BsaI en los dos fragmentos que codifican ITR no están mutados, en caso de que haya características de la secuencia de ADN que fueran importantes para la replicación eficiente del ADN y la resolución del concatámero.

            Para la reactivación inicial, la timidina quinasa en VACV (ACAM2000) se reemplaza con el casete yfp/gpt para ayudar a recuperar partículas de VACV recién reactivadas.

            TABLA 7 Los fragmentos del genoma del VVAC ACAM2000 utilizados en este estudio. El tamaño, ubicación dentro del VACV ACAM2000 genoma [acceso a GenBank AY313847] y superposición con fragmentos adyacentes se describen. Superposición con adyacente Nombre del fragmento Tamaño (pb) Ubicación (pb) fragmento (pb) GA_LITR 18,073    1-18,073 — (A2000) Frag_1 (2287) (SEQ ID NO: 50) GA_Frag_1 24,895 15,787-40,681 LITRO (2287) (A2000) Frag_2 (1342) (SEC ID Nº: 51) GA_Frag_2 23,297 39,340-62,636 Frag_1 (1342) (A2000) Frag_3 (2453) (SEC ID Nº: 52) GA_Frag_3 24,971 60,184-85,154 Frag_2 (2453) (A2000) Frag_4 (1604) (SEQ ID NO: 53) GA_Frag_4 26,575  83,551-110,125 Frag_3 (1604) (A2000) Frag_5 (1896) (SEQ ID NO: 54) GA_Frag_5 24,635 108,230-132,864 Frag_4 (1896) (A2000) Frag_6 (2129) (SEQ ID NO: 55) GA_Frag_6 25,934 130.736-156.669 Frag_5 (2129) (A2000) Frag_7 (2183) (SEQ ID NO: 56) GA_Frag_7 28,801 154.487-183.287 Frag_6 (2183) (A2000) RITR (1403) (SEQ ID NO: 57) GA_RITR 17,350 181.885-199.234 Frag_7 (1403) (A2000) — (SEQ ID NO: 58)

            Ligadura de las formas S y F de los bucles terminales (de la cepa ACAM2000 de VVAC) en los extremos izquierdo y derecho de los ITR de VVAC
            Para preparar los fragmentos de ITR de VACV para transfectarlos en células infectadas con SFV, los bucles de horquilla terminales se ligan a los fragmentos de ITR izquierdo y derecho utilizando los mismos métodos utilizados para unir horquillas de VACV a los telómeros de HPXV descritos. Brevemente, a través de la síntesis de ADN, se deja un saliente 5′ compuesto por tres nucleótidos al final de cada horquilla (5′-ACA; como se describe en los Ejemplos 1 y 2). Mientras tanto, los clones de plásmido que codifican los fragmentos ITR de VACV izquierdo y derecho están diseñados para codificar un sitio de reconocimiento de SapI ubicado inmediatamente adyacente al primer nucleótido que codifica el inicio del genoma de VACV. Digerir el clon ITR con SapI crea un saliente de tres bases (5′-TGT), complementario al saliente 5′-ACA en la estructura de bucle de horquilla terminal. Los fragmentos ITR izquierdo o derecho se mezclan con un exceso molar de ~20 veces de los bucles terminales y se ligan. Esto produce una copia terminada en horquilla de cada ITR.

            Recombinación y reactivación de scACAM2000 catalizada por leporipoxvirus

            Después de la digestión y la limpieza del ADN de los fragmentos de ADN genómico del VVAC, se transfectan en células BGMK infectadas con el SFV. Como se describió anteriormente, el virus auxiliar SFV catalizará la recombinación entre fragmentos que comparten secuencias homólogas flanqueantes, lo que dará como resultado la creación de genomas de VVAC completos que pueden empaquetarse y liberarse de la célula. Es poco probable que se produzcan virus híbridos en este ensayo. Después de 4 días, las células BGMK se recolectan y las partículas de virus VVAC reactivadas se liberan mediante congelación-descongelación, seguido de siembra en placas sobre las células BSC-40 susceptibles. Las placas reactivadas de VACV (ACAM2000) son los únicos virus que forman placas en las células BSC-40.

            Ejemplo 12. Seguridad e inmunogenicidad de scHPXV en un modelo animal pequeño
            Materiales y métodos
            Modelo intranasal murino de infección por scHPXV.

            Se adquieren ratones BALB/c de seis a ocho semanas de Charles River Laboratories. Se infectan grupos de cinco ratones por vía intranasal (o infección simulada) con 5 × 10 3 PFU VVAC (cepa WR), 1 × 10 7 VVAC (Dryvax DPP15) o 1 × 10 5 PFU, 1 × 10 6 PFU o 1 × 10 7 UFP de scHPXV YFP-gpt::095 (descrito en los Ejemplos 1-6) o scHPXV (wt) (descrito en los Ejemplos 7 y 8) en 10 μl de PBS. Los ratones se pesan diariamente durante 28 días y se puntúan los siguientes signos clínicos: pelaje despeinado, dificultad para respirar, movilidad reducida y lesiones de viruela. Los ratones que pierden el 25% del peso inicial se sacrifican. Estos ratones vacunados se exponen posteriormente por vía intranasal a 1 × 10 6PFU VACV (cepa WR), pesado y controlado diariamente para signos clínicos de enfermedad como se describe anteriormente durante 13 días. Los ratones que pierden el 25 % del peso inicial se sacrifican según los protocolos aprobados por el comité local de cuidado y uso de animales.

            Resultados
            Las cepas de scHPXV no causan pérdida de peso en un modelo murino intranasal de infección por poxvirus

            Los efectos de toxicidad de scHPXV YFP-gpt::095 o scHPXV (wt) se examinan en un modelo murino intranasal de infección por poxvirus. Los ratones se inoculan por vía intranasal con la(s) dosis indicada(s) de scHPXV (wt) y se controlan sus pesos durante un período de 28 días. No se observa pérdida de peso en ratones inoculados con ninguna de las dosis de scHPXV YFP-gpt::095 o scHPXV (wt) durante el período de 28 días ( HIGO. 10 ). Esto contrasta con los animales inoculados con Dryvax DPP15 (10 7 PFU) o VACV WR (5×10 3 PFU), que pierden una media del 15 % y el 10 % de su peso inicial, respectivamente. Estos datos sugieren que incluso a la dosis más alta de scHPXV (wt) y scHPXV YFP-gpt::095 probada (107 PFU ), no se observan efectos adversos. Sin embargo, con una cepa de vacuna contra la viruela conocida, DPP15, se detecta una pérdida de peso transitoria en ratones a los 7 días después de la inoculación, aunque estos ratones vuelven a su peso inicial a los 10 días después de la inoculación.

            scHPXV YFP-Gpt::095 (10 6 y 10 7 PFU) y scHPXV (Wt) (10 5 , 10 6 , 10 7 PFU) confieren protección inmunitaria contra un desafío letal de WR por VVAC en ratones BALB/c

            Después de la inmunización de 28 días de ratones BALB/c con las cepas indicadas de scHPXV YFP-gpt::095, scHPXV (wt), DPP15 y VACV WR ( HIGO. 10 ), los ratones se exponen posteriormente a una dosis intranasal letal de VACV WR (10 6 PFU) para evaluar la eficacia protectora de scHPXV (wt) o scHPXV YFP-gpt::095 en ratones. Todos los ratones tratados inicialmente con PBS sucumbieron a la infección, mientras que los animales expuestos inicialmente a 10 7 PFU de Dryvax (DPP15) o 5×10 3 PFU de VACV WR no muestran pérdida de peso ( HIGO. 11A ) y sin signos de enfermedad ( HIGO. 11B ). Los animales vacunados con las dos dosis más bajas de scHPXV YFP-gpt::095 muestran pérdida de peso ( HIGO. 11A ) y signos de enfermedad grave basados ​​en puntuaciones clínicas ( HIGO. 11B ) y también se observa que dos animales en las dosis más bajas de scHPXV YFP-gpt::095 sucumben a la infección ( HIGO. 12 ). Se observa que los animales restantes en estos grupos de dosis baja de scHPXV YFP-gpt::095 finalmente se recuperan de la infección, pero sus pesos siguen siendo más bajos que los pesos promedio en el resto de los grupos. Los animales expuestos previamente a 10 5 a 10 7 UFP de scHPXV (wt) muestran solo una pérdida de peso transitoria menor en los primeros días posteriores al desafío con poxvirus ( HIGO. 11A ), y sin signos clínicos de enfermedad ( HIGO. 11B ). Estos datos muestran que scHPXV puede infectar e inmunizar ratones contra un desafío letal de VVAC y puede hacerlo sin causar enfermedad durante el paso de inmunización inicial.

            Reclamación (es
            1. Un poxvirus quimérico sintético (scPV) que se replica y reactiva a partir de ADN derivado de ADN sintético, diferenciándose el genoma viral de dicho virus de un genoma de tipo salvaje de dicho virus en que se caracteriza por una o más modificaciones, siendo las modificaciones derivado de un grupo que comprende ADN sintetizado químicamente, ADNc o ADN genómico.

            2. El scPV de la reivindicación 1, en el que el ADN sintético se selecciona de uno o más de: ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado y polinucleótidos que comprenden análogos de nucleósidos.

            3. El scPV de la reivindicación 1, en el que el ADN sintético es ADN sintetizado químicamente.

            4. El scPV de cualquiera de las reivindicaciones 1 a 3, en el que una o más modificaciones comprenden una o más deleciones, inserciones, sustituciones o una combinación de las mismas.

            5. (cancelado)

            6. El scPV de una cualquiera de las reivindicaciones 1 a 4, en el que el genoma viral comprende bucles en horquilla terminales heterólogos.

            7. El scPV de una cualquiera de las reivindicaciones 1 a 4 o la reivindicación 6, en el que el genoma viral comprende bucles en horquilla terminales derivados del virus vaccinia.

            8. El scPV de la reivindicación 7, en el que los bucles en horquilla terminales izquierdo y derecho a) comprenden la forma lenta y la forma rápida del bucle en horquilla terminal del virus vaccinia, respectivamente, b) comprenden la forma rápida y la forma lenta del virus vaccinia bucle terminal en horquilla, respectivamente, c) ambos comprenden la forma lenta del bucle terminal del virus vaccinia, o d) ambos comprenden la forma rápida del bucle terminal del virus vaccinia.

            9. El scPV de una cualquiera de las reivindicaciones 1 a 4 o 6 a 8, en el que el virus se replica y reactiva a partir de fragmentos de ADN sintetizados químicamente superpuestos que corresponden sustancialmente a todo el genoma viral del scPV.

            10. El scPV de la reivindicación 9, en el que el virus se replica y reactiva a partir de 1-14 fragmentos superpuestos.

            11.-12. (cancelado)

            13. El scPV de una cualquiera de las reivindicaciones 1 a 4 o 6 a 10, en el que el virus se reactiva usando recombinación y reactivación catalizadas por el virus del leporipox.

            14. (cancelado)

            15. Un ortopoxvirus quimérico sintético (scOPV) que se replica y reactiva a partir de ADN derivado de ADN sintético, diferenciándose el genoma viral de dicho virus de un genoma de tipo salvaje de dicho virus en que se caracteriza por una o más modificaciones, las modificaciones siendo derivados de un grupo que comprende ADN sintetizado químicamente, ADNc o ADN genómico.

            16. La scOPV de la reivindicación 15, en la que el ADN sintético se selecciona de uno o más de: ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado y polinucleótidos que comprenden análogos de nucleósidos.

            17. La scOPV de la reivindicación 15, en la que el ADN sintético es ADN sintetizado químicamente.

            18. La scOPV de cualquiera de las reivindicaciones 15 a 17, donde el genoma viral de la scOPV se basa en una OPV seleccionada del grupo que consiste en: virus de la viruela del camello (CMLV), virus de la viruela bovina (CPXV), virus de la ectromelia (ECTV), virus de la viruela del caballo (HPXV), virus de la viruela del simio (MPXV), virus de la vaccinia (VACV), virus de la viruela (VARV), virus de la viruela del conejo (RPXV), virus de la viruela del mapache, virus de la viruela del zorrillo, virus de la viruela del mapache, virus de la enfermedad de Uasin Gishu y virus de la volepox.

            19. La scOPV de cualquiera de las reivindicaciones 15 a 18, en la que el genoma viral de la scOPV se basa en un VACV.

            20. La scOPV de la reivindicación 19, en la que el genoma viral de la scOPV se basa en el genoma de la cepa ACAM2000 del VVAC y difiere del genoma de la ACAM2000 en que se caracteriza por una o más modificaciones.

            21. La scOPV de la reivindicación 19, en la que el genoma viral de la scOPV se basa en el genoma de la cepa IOC del VVAC y se diferencia del genoma de la IOC en que se caracteriza por una o más modificaciones.

            22. La scOPV de la reivindicación 19, en la que el genoma viral de la scOPV se basa en el genoma de la cepa MVA del VVAC y difiere del genoma de la MVA en que se caracteriza por una o más modificaciones.

            23. (cancelado)

            24. La scOPV de la reivindicación 19, donde el genoma del VVAC de tipo salvaje es el genoma de una cepa seleccionada del grupo que consiste en: Western Reserve, Clon 3, Tian Tian, ​​Tian Tian clone TT9, Tian Tian clone TP3, NYCBH, Wyeth, Copenhague, Lister 107, Lister-LO, IHD-W, LC16m18, Lederle, Tashkent clon TKT3, Tashkent clon TKT4, URSS, Evans, Praha, LIVP, Ikeda, EM-63, Malbran, Duke, 3737, CV-1, Connaught Laboratories, Serro 2, CM-01, Dryvax clon DPP13, Dryvax clon DPP15, Dryvax clon DPP20, Dryvax clon DPP17, Dryvax clon DPP21 y corioalantoides vaccinia virus Ankara.

            25. La scOPV de cualquiera de las reivindicaciones 15 a 22 ó 24, en la que una o más modificaciones comprenden una o más deleciones, inserciones, sustituciones o una combinación de las mismas.

            26.-30. (cancelado)

            31. La scOPV de una cualquiera de las reivindicaciones 15 a 22 o 24 o 25, en la que el genoma viral comprende bucles en horquilla terminales heterólogos.

            32. La scOPV de una cualquiera de las reivindicaciones 15 a 22 o 24 o 25, en la que el genoma viral comprende bucles en horquilla terminales derivados del virus vaccinia.

            33. La scOPV de la reivindicación 32, en la que los bucles en horquilla terminales izquierdo y derecho a) comprenden la forma lenta y la forma rápida del bucle en horquilla terminal del virus vaccinia, respectivamente, b) comprenden la forma rápida y la forma lenta del virus vaccinia bucle terminal en horquilla, respectivamente, c) ambos comprenden la forma lenta del bucle terminal del virus vaccinia, o d) ambos comprenden la forma rápida del bucle terminal del virus vaccinia.

            34. La scOPV de la reivindicación 33, en la que la forma lenta comprende una secuencia de nucleótidos que es al menos un 85% idéntica a la secuencia de nucleótidos de SEQ ID NO: 11 y la forma rápida comprende una secuencia de nucleótidos que es al menos un 85% idéntica a la secuencia de nucleótidos de SEQ ID NO: 12.

            35.-36. (cancelado)

            37. La scOPV de la reivindicación 33, donde la forma lenta consiste en la secuencia de nucleótidos de SEQ ID NO: 11 y la forma rápida consiste en la secuencia de nucleótidos de SEQ ID NO: 12.

            38. La scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37, donde el virus se replica y reactiva a partir de fragmentos de ADN sintetizados químicamente superpuestos que corresponden sustancialmente a todo el genoma viral de la OPV.

            39. La scOPV de la reivindicación 38, en la que el virus se replica y reactiva a partir de 1-14 fragmentos superpuestos.

            40.-41. (cancelado)

            42. La scOPV de una cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39, en la que el virus se reactiva usando recombinación y reactivación catalizadas por el virus del leporipox.

            43. (cancelado)

            44. Un virus de la viruela quimérica sintética (scHPXV) que se replica y reactiva a partir de ADN sintético, el genoma viral difiere de un genoma de tipo salvaje de HPXV en que se caracteriza por una o más modificaciones, las modificaciones se derivan de un grupo que comprende químicamente ADN sintetizado, ADNc o ADN genómico.

            45. El scHPXV de la reivindicación 44, en el que el ADN sintético se selecciona de uno o más de: ADN sintetizado químicamente, ADN amplificado por PCR, ADN manipulado y polinucleótidos que comprenden análogos de nucleósidos.

            46. ​​El scHPXV de la reivindicación 44, en el que el ADN sintético es ADN sintetizado químicamente.

            47. El scHPXV de cualquiera de las reivindicaciones 44 a 46, donde el genoma viral se basa en el genoma de la cepa MNR-76 de HPXV y difiere del genoma de MNR-76 en que se caracteriza por una o más modificaciones.

            48. El scHPXV de una cualquiera de las reivindicaciones 44 a 47, en el que una o más modificaciones comprenden una o más deleciones, inserciones, sustituciones o una combinación de las mismas.

            49.-55. (cancelado)

            56. El scHPXV de cualquiera de las reivindicaciones 44 a 48, en el que una o más modificaciones comprenden una o más mutaciones enumeradas en la Tabla 2.

            57. El scHPXV de una cualquiera de las reivindicaciones 44 a 48 ó 56, en el que el genoma viral comprende bucles en horquilla terminales heterólogos.

            58. El scHPXV de la reivindicación 57, en el que el genoma viral comprende bucles en horquilla terminales derivados del virus vaccinia.

            59. El scHPXV de la reivindicación 58, en el que los bucles en horquilla terminales izquierdo y derecho a) comprenden la forma lenta y la forma rápida del bucle en horquilla terminal del virus vaccinia, respectivamente, b) comprenden la forma rápida y la forma lenta del virus vaccinia bucle terminal en horquilla, respectivamente, c) ambos comprenden la forma lenta del bucle terminal del virus vaccinia, o d) ambos comprenden la forma rápida del bucle terminal del virus vaccinia.

            60. El scHPXV de la reivindicación 59, en el que la forma lenta comprende una secuencia de nucleótidos que es al menos un 85% idéntica a la secuencia de SEQ ID NO: 11 y la forma rápida comprende una secuencia de nucleótidos que es al menos un 85% idéntica a la secuencia de nucleótidos secuencia de SEQ ID NO: 12.

            61.-62. (cancelado)

            63. El scHPXV de la reivindicación 59, donde la forma lenta consiste en la secuencia de nucleótidos de SEQ ID NO: 11 y la forma rápida consiste en la secuencia de nucleótidos de SEQ ID NO: 12.

            64. El scHPXV de la reivindicación 57, en el que el genoma viral comprende bucles en horquilla terminales derivados del virus de la viruela del camello, el virus de la viruela de la vaca, el virus de la ectromelia, el virus de la viruela del mono, el virus de la viruela, el virus de la viruela del conejo, el virus de la viruela del mapache, el virus de la viruela del zorrillo, el virus Taterapox, el virus de la enfermedad de Uasin Gishu, o virus de la viruela viral.

            65. El scHPXV de una cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 o 64, en el que el virus se replica y se ensambla a partir de fragmentos de ADN superpuestos sintetizados químicamente que corresponden sustancialmente a todo el genoma viral de HPXV.

            66. El scHPXV de la reivindicación 65, en el que el virus se replica y reactiva a partir de 1-14 fragmentos superpuestos.

            67.-68. (cancelado)

            69. El scHPXV de una cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66, en el que el virus se reactiva usando recombinación y reactivación catalizadas por virus leporipox.

            70. (cancelado)

            71. Un método para producir un poxvirus quimérico sintético (scPV) que comprende los pasos de:

            (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma viral del poxvirus;
            (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con virus auxiliares;
            (iii) cultivar dichas células para producir una mezcla de virus auxiliar y partículas poxvirales quiméricas sintéticas en dichas células; y
            (iv) sembrar la mezcla en células huésped específicas del scPV para recuperar el scPV.
            72. El método de la reivindicación 71, en el que el virus auxiliar es un virus de leporipox.

            73.-74. (cancelado)

            75. El método de la reivindicación 71, en el que el virus auxiliar es el virus de la viruela aviar.

            76. El método de la reivindicación 71, en el que el virus auxiliar es un virus auxiliar inactivado con psoraleno.

            77. (cancelado)

            78. El método de una cualquiera de las reivindicaciones 71 a 72, en el que el paso (i) comprende además sintetizar químicamente bucles terminales en horquilla de un poxvirus y ligarlos a los fragmentos que comprenden los extremos izquierdo y derecho del genoma viral.

            79. Un método para producir un ortopoxvirus quimérico sintético (scOPV) que comprende los pasos de:

            (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma viral de la OPV;
            (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con virus auxiliares;
            (iii) cultivar dichas células para producir una mezcla de virus auxiliares y partículas de scOPV en dichas células; y
            (iv) sembrar la mezcla en células huésped específicas de OPV para recuperar la scOPV.
            80. El método de la reivindicación 79, en el que el virus auxiliar es un virus de leporipox.

            81.-82. (cancelado)

            83. El método de la reivindicación 79, en el que el virus auxiliar es el virus de la viruela aviar.

            84. El método de la reivindicación 79, en el que el virus auxiliar es un virus auxiliar inactivado con psoraleno.

            85.-86. (cancelado)

            87. El método de cualquiera de las reivindicaciones 79 o 80 o 83 o 84, donde la OPV se selecciona del grupo que consiste en: virus de la viruela del camello, virus de la viruela bovina, virus de la ectromelia, virus de la viruela equina, virus de la viruela del mono, virus vaccinia, virus variólico, virus de la viruela del conejo virus de la viruela del mapache, virus de la viruela de la mofeta, virus Taterapox, virus de la enfermedad de Uasin Gishu, virus volepox.

            88. El método de cualquiera de las reivindicaciones 79, 80, 83, 84 u 87, en el que el paso (i) comprende además sintetizar químicamente bucles terminales en horquilla de una OPV y ligarlos a los fragmentos que comprenden los extremos izquierdo y derecho del genoma viral. .

            89. Un método para producir un virus de la viruela equina quimérico sintético (scHPXV) que comprende los pasos de:

            (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma de HPXV;
            (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con virus auxiliares;
            (iii) cultivar dichas células para producir una mezcla de virus auxiliares y partículas de scHPXV en dichas células; y
            (iv) sembrar la mezcla en células huésped específicas de HPXV para recuperar el scHPXV.
            90. El método de la reivindicación 89, en el que el virus auxiliar es un virus de leporipox.

            91.-92. (cancelado)

            93. El método de la reivindicación 89, en el que el virus auxiliar es el virus de la viruela aviar.

            94. El método de la reivindicación 89, en el que el virus auxiliar es un virus auxiliar inactivado con psoraleno.

            95.-96. (cancelado)

            97. El método de una cualquiera de las reivindicaciones 89, 90, 93 o 94, en el que el paso (i) comprende además sintetizar químicamente bucles en horquilla terminales de una OPV y ligarlos a los fragmentos que comprenden los extremos izquierdo y derecho del genoma de HPXV.

            98. El método de una cualquiera de las reivindicaciones 89 o 90 o 93 o 94 o 97, en el que los fragmentos de ADN superpuestos comprenden:

            i) secuencias de nucleótidos que son al menos 85% idénticas a las secuencias de SEQ ID NO: 1-10;
            ii) secuencias de nucleótidos que son al menos 90% idénticas a las secuencias de SEQ ID NO: 1-10;
            (iii) secuencias de nucleótidos que son al menos 95% idénticas a las secuencias de SEQ ID NO: 1-10; o
            (iv) secuencias de nucleótidos que consisten en las secuencias de SEQ ID NO: 1-10.
            99. Un método para producir un virus de la viruela equina quimérico sintético (scHPXV) que comprende:

            (i) sintetizar químicamente fragmentos de ADN superpuestos que corresponden sustancialmente a todo el genoma de HPXV;
            (ii) transfectar los fragmentos de ADN superpuestos en células infectadas con el virus del fibroma de Shope (SFV);
            (iii) cultivar dichas células para producir una mezcla de partículas de SFV y scHPXV en dichas células; y
            (iv) sembrar la mezcla en células huésped específicas de HPXV para recuperar el scHPXV.
            100.-101. (cancelado)

            102. Un poxvirus quimérico sintético (scPV) generado por el método de cualquiera de las reivindicaciones 71 a 72 o 75 o 76 o 78.

            103. Un ortopoxvirus quimérico sintético (scOPV) generado por el método de cualquiera de las reivindicaciones 79, 80, 83, 84, 87 u 88.

            104. Un virus de la viruela equina quimérico sintético (scHPXV) generado por el método de cualquiera de las reivindicaciones 89 o 90 o 93 o 94 o 97 a 99.

            105. Una composición que comprende un vehículo farmacéuticamente aceptable y el scPV de cualquiera de las reivindicaciones 1 a 4 o 6 a 10 o 13 o 102.

            106. Una composición que comprende un vehículo farmacéuticamente aceptable y la scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 103.

            107. Un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende la scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 103.

            108. Un método para desencadenar o potenciar una respuesta inmune contra el virus vaccinia, que comprende administrar a un sujeto que lo necesite una composición que comprende la scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 103.

            109. Un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela símica, que comprende administrar a un sujeto que lo necesite una composición que comprende la scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 103.

            110. Un método para inmunizar a un sujeto humano para protegerlo de la infección por el virus de la viruela, que comprende administrar a dicho sujeto una composición que comprende la scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 103.

            111. Un método para tratar una infección por el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende la scOPV de cualquiera de las reivindicaciones 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 103.

            112. Una composición que comprende un vehículo farmacéuticamente aceptable y el scHPXV de cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66 o 69 o 104.

            113. Un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende el scHPXV de cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66 o 69 o 104.

            114. Un método para desencadenar o potenciar una respuesta inmune contra el virus vaccinia, que comprende administrar a un sujeto que lo necesite una composición que comprende el scHPXV de cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66 o 69 o 104.

            115. Un método para desencadenar o potenciar una respuesta inmunitaria contra el virus de la viruela símica, que comprende administrar a un sujeto que lo necesite una composición que comprende el scHPXV de cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66 o 69 o 104.

            116. Un método para inmunizar a un sujeto humano para protegerlo de la infección por el virus de la viruela, que comprende administrar a dicho sujeto una composición que comprende el scHPXV de cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66 o 69 o 104.

            117. Un método para tratar una infección por el virus de la viruela, que comprende administrar a un sujeto que lo necesite una composición que comprende el scHPXV de cualquiera de las reivindicaciones 44 a 48 o 56 a 60 o 63 a 66 o 69 o 104.

            118.-123. (cancelado)

            124. Una instalación de tratamiento de poxvirus en la que los sujetos que necesitan inmunización o tratamiento con una composición que comprende el virus de cualquiera de las reivindicaciones 1 a 4 o 6 a 10 o 13 o 15 a 22 o 24 o 25 o 31 a 34 o 37 a 39 o 42 o 44 a 48 o 56 a 60 o 63 a 66 o 69 o 102 a 106 o la composición de cualquiera de las reivindicaciones 105, 106 o 112 pueden inmunizarse o tratarse en un entorno tal que sean secuestrados de otros sujetos no está destinado a ser inmunizado o tratado.

            125. La instalación de tratamiento de poxvirus de la reivindicación 124 que se caracteriza por contar con especialistas en eventos adversos de viruela para administrar la inmunización o el tratamiento.

            126. (cancelado)

            127. La instalación de tratamiento de poxvirus de cualquiera de las reivindicaciones 124 o 125, en la que los sujetos que necesitan inmunización o tratamiento son inmunizados o tratados de acuerdo con los métodos de cualquiera de las reivindicaciones 107 a 111 o 113 a 117.

            Historial de patentes
            Número de publicación : 20180251736
            Tipo: Solicitud
            presentada : 2 de noviembre de 2017
            Fecha de publicación : 6 de septiembre de 2018
            Inventores : David Evans (Edmonton), Ryan Noyce (Edmonton), Seth Lederman (Nueva York, NY)
            Número de solicitud : 15/802,189
            Clasificaciones
            Clasificación Internacional : C12N 7/00 (20060101); A61K 39/275 (20060101);

            F*I*N

    1. Zack Saetonious

      CMe recuerda a un capitulo de la serie 12 monos en los que unos traficantes de medicamentos quieren vender una medicina trucha a multimillonarios desesperados ……. cuando su dinero es escoria ante el valor de cura

      1. Yosef Arad

        OPINO LO MISMO ZACK
        SOLO QUE YO VI LA PELICULA «12 MONOS» LA QUE INTERPRETÓ EL AHIRA REBQUEABTE Y ENFERMO PIR HABERSE J@KUN@DO BRUCE WILLIS
        LA SERUE BO KA VU
        BENDICIONES

  22. Zack Saetonious

    LOS MULTIMILLONARIOS SE PREPARAN PARA EL ACABOSE QUE ESTA EN CURSO DIRECTO A COLISIONAR SOBRE ELLOS …. FINALMENTE COSECHARAN LO QUE SEMBRARON …. EL EFECTO SRI LANKA RECARGADO
    ——————————————————————————————————————————————————-
    Los bancos globales y las empresas de inversión se preparan en secreto para un peligroso aumento de los disturbios civiles en los EE. UU., el Reino Unido y Europa.
    19 de mayo de 2022

    Los bancos globales y las firmas de inversión se están preparando para un aumento «sin precedentes» de los disturbios civiles en los EE. UU., el Reino Unido y Europa, ya que los aumentos en los precios de la energía y los alimentos aumentarán los costos de vida a niveles astronómicos.

    La información proviene del jefe de un ‘grupo de instituciones financieras’, que brinda experiencia y servicios de asesoría a otros bancos, compañías de seguros y otras instituciones financieras, en una de las firmas de inversión más grandes de los EE. UU.

    El alto ejecutivo de inversiones, que habló con Byline Times bajo condición de anonimato porque la información que reveló se considera altamente confidencial, dijo que los planificadores de contingencia de las principales instituciones financieras creen que los «niveles peligrosos» de ruptura social en Occidente ahora son casi inevitables, y inminente. Se espera que ocurra un estallido de disturbios civiles en cualquier momento de este año, pero lo más probable es que ocurra en los próximos meses a medida que el impacto de la crisis del costo de vida comience a saturar las vidas de «todos».

    El ejecutivo trabaja en una firma líder de Wall Street, considerada una institución financiera sistémicamente importante por la Junta de Estabilidad Financiera de EE. UU. Se trata de instituciones cuyo funcionamiento se considera fundamental para la economía estadounidense y cuyo fracaso podría desencadenar una crisis financiera.

    Según el ejecutivo, los principales bancos de todo el mundo, incluidos EE. UU., Reino Unido y Europa Occidental, están instruyendo a sus altos directivos para que comiencen a planificar activamente cómo responderán al impacto de la interrupción financiera provocada por un episodio prolongado de disturbios civiles. Sin embargo, el funcionario bancario no dio más detalles sobre lo que implican estas medidas de planificación más allá de la referencia a las pruebas de estrés para determinar el impacto en las carteras de inversión.

    Si bien el aumento de los disturbios civiles en los países en desarrollo ha sido discutido abiertamente por importantes instituciones como la ONU, el Banco Mundial, el FMI y otras instituciones, esta es la primera vez en los últimos años que las expectativas de una próxima epidemia de descomposición social en las sociedades occidentales se han atribuido a las principales empresas bancarias y de inversión.

    “Todos los principales bancos saben que la crisis del costo de vida está fuera de control”, dijo el principal asesor financiero.

    “La pandemia fue lo suficientemente mala y destacó cómo ciertos grupos de personas se verían más afectados, los pobres, las minorías, etc. Pero la combinación de choques energéticos y alimentarios es un punto de inflexión que empujará a las sociedades occidentales al límite. Esto impactará a todos. A las clases medias acomodadas les resultará difícil comprar alimentos básicos y pagar las facturas. Por lo tanto, anticipamos niveles peligrosos de disturbios civiles que podrían convertirse en una crisis social sin precedentes”.

    La advertencia se produce cuando el gobernador del Banco de Inglaterra, Andrew Bailey, describió cómo los aumentos «apocalípticos» de los precios de los alimentos y la energía y una tasa de inflación alta en 30 años conducirían a un «impacto de ingresos muy grande» que aumentaría el desempleo y reduciría drásticamente el gasto de los hogares.

    Pero eso apenas araña la superficie. El alto funcionario bancario de EE. UU. advirtió a Byline Times que la crisis actual estaba a punto de hundir al público en general, incluidas las clases medias, en una pobreza cada vez mayor. Peor aún, la caja de herramientas económicas convencionales para hacer frente a la volatilidad financiera se había agotado:

    “No queda nada en la caja de herramientas del sistema financiero existente. Nos hemos quedado sin opciones. Solo puedo ver que la situación empeora”.

    El funcionario afirmó que se habían enterado de la planificación interna de varios bancos a través de conversaciones con colegas de alto nivel en las últimas semanas.

    Las advertencias del funcionario encajan en un análisis que preparé en 2017 en el que argumenté que una combinación de crisis energética, alimentaria y de deuda similar a la que habíamos visto en el período previo a la crisis financiera de 2008 probablemente reaparecería en el próximo años de forma más intensa. El sistema global, advertí, estaba en medio de un proceso de colapso prolongado a medida que el paradigma dominante de los combustibles fósiles se desmorona en una espiral de rendimientos decrecientes. Aunque esperaba que esta convergencia de crisis global ocurriera antes, se retrasó por el impacto de la pandemia, que redujo temporalmente la demanda y el consumo global.

    Un gran estallido de disturbios civiles este año sería consistente con una tendencia creciente en la violencia política durante la última década desde la crisis financiera de 2008, según lo documentado por el Índice de Paz Global del Instituto para la Economía y la Paz. Entre 2011 y 2019, las manifestaciones, huelgas y disturbios en todo el mundo aumentaron un 244 % y continuaron aumentando en 2020 durante la pandemia.

    Las últimas cifras del Índice de Paz Global muestran que la paz global se ha deteriorado por novena vez consecutiva en un 0,07% y, en general, ha empeorado en los últimos 15 años. Ahora se han producido violentas manifestaciones y disturbios en 158 países, más del 80% del mundo. Esta tendencia creciente de disturbios civiles encaja en un patrón de malestar social ‘sistémico’, con múltiples países expresando simultáneamente insatisfacción, enojo y exigiendo cambios.

    La tendencia al alza no comenzó hace 15 años. También es parte de una tendencia ascendente mucho más prolongada en la violencia política que comenzó a acelerarse especialmente desde la década de 1970, cuando la economía global entró por primera vez en una etapa de ‘sobregiro’ ecológico.

    La evidencia de una creciente inestabilidad en el sistema global sugiere que está entrando en un período de cambios rápidos y dramáticos a medida que las industrias e instituciones políticas establecidas están perdiendo el control. Si bien la perspectiva de intensificar la inestabilidad es desalentadora, el debilitamiento del statu quo está abriendo un nuevo espacio de posibilidades para explorar alternativas antes impensables.

    Los gerentes del paradigma actual no pueden ver esta oportunidad. En particular, no pueden reconocer que el ciclo de retroalimentación de la aceleración de las crisis energética, económica y alimentaria se está intensificando porque las industrias dominantes intensivas en carbono en estos sectores son económicamente obsoletas, con enormes consecuencias geopolíticas a medida que se desmoronan ante nuestros ojos.

    Contrariamente al sombrío fatalismo de las instituciones financieras establecidas, que no ven salida a una crisis creada por ellas mismas, las nuevas visiones e ideas para la transformación económica, junto con la continua aceleración de las disrupciones tecnológicas clave en la energía, el transporte y los alimentos, sugieren que la mismo colapso del paradigma actual está allanando el camino para un avance hacia un nuevo sistema. Pero los ciudadanos, incluidos los que trabajan en el sector financiero, deben ser capaces de ver esta oportunidad antes de poder aprovecharla.

    https://bylinetimes.com/2022/05/17/global-banks-privately-prepare-for-dangerous-levels-of-imminent-civil-unrest-in-western-homelands/

  23. Yosef Arad

    QUERIDO NOTARIO:
    ANTE TODO GRACIAS PIR LA DEFERENCIA QUE GAS TENIDO DE VOLVER A INSERTAS AL FINAL DEL VIDEO LA SUBLINE BENDICION AARONICA .
    TAMBIÉN QUIERO AGRADECERTE LA PACIENCIA QUE DEMUESTRAS SEMANA TRAS SEMANA PARA CON MIS ERRORES DE TRANSCRIPCION.
    CREENE QUE ME ESFUERZO EN NO COMETERLOS PERO MI TORPEZA A VECES SUPERA MI PROPÓSITO DE ENMIENDA.
    EN OTRO ORDEN DE COSAS GE DE ACKARAR QUE NO ME CUERRO A OTRAS POSIBLES EXPLICACIINES A LA FALSA EPIDEMIA DEL FABULADO COC1D.
    SIMPLEMENTE REITERO(NO PIRQUE TO LO PIENSE ASÍ SINONPORQUE LO ACREDITAN INFORNES ANALUTICOS DE LOS MÁS EXIMIOS CIENTÍFICOS)QUE HASTA LA FECGA NO SE GAN HALKADO EN LAS K@KUN@S ANALUZADAS NI UN SOLO COMPONENTE O RESIDUO DE ORIGEN VIRICO O BACTERIANO SINO QYE TANTO LOS RESTOS COMO LAS MICROESTRUCTURAS HALLADAS EN LAS MUESTRAS SOLO MUESTRAN UN ELEMENTO EL ÓXIDO DE GR4F3N0(R) Y LAS MICROFIBRAS DE LAS QUE SE DESCONOCÍA SU COMPOSICIÓN RESUKTA QUE TAMBIEN SON DE ESE ELEMENTI.
    PIR SUPUESTO QUE TAMBIEN HAY QUE COBSIDERAR LOS «CHEMTRAILS» QUE ARRIJAN METAKES PESADOS PERI TANTO EN UNO COMO EN OTRO CADO NO HAY BINGUN EKENENTO VIRICO O BACTERIANO DE CARÁCTER INFECCIOSO.
    EN AMBOS CASIS SE TRATA DE UNA INTOXICACIÓN(ENVENENAMIENTO SU QUIERES) PERO NUNCA DE UNA INFECCUINA DIARII LOS SERES HUMANOS CONVIVIMOS CON CIENTOS DE MILES DE VIRUS QUE NO NOS CAUSAN EL MENIR DAÑI.
    LO VERDADERAMENTE LETAL ES KA INMUNODEFICIENCIA QUE DEJA AL IRGANUSNO INERNE ANTE ELLOS Y QUE ES PROVOCADA PIR AGEBTES TOXICOS T NO VIRICOS COMO ES EL CASO DE MIS CHEMTRAILS Y DEL OXUDO DE GR4 INOCULADO EN K@KUN@S E INPREGBADO EN PCRS AGUA COMIDA BOZALES HUDROGELES EVINCLUSO EN EK AIRE QUE RESPIEAMIS.
    EN DEFIBIRUVA LIS AGENTES VIRICOS y BACTERIANO S SON EL EFECTO NO LA CAUSA DE KAS EBFERMEDADES INFECCUISAS.
    TE ADJUNTO VIDEO QUE HE TENIDO QUE VER VARUAA CECES DEBIDO A SU COMPKEJUDAD PARA KIS PROFANOS EN ESRAS CUEBXUAS (COMO TI) EN EK QYE SE DENYESTEA TIDO ESTO QYE TE CONEBTO
    «REFUTACION DEFINITIVA DE LA VIROLOGIA»
    https://odysee.com/ladefinitivarefudelavirol.1:c0c6cc7ea17a9a4c919f963f5350a4a85e2efe36
    POR UKTIMO EN CUANTO A LO QUE CINEBTAS DE KA PUEDRA FILISOFAL MI HUMILDE OPINION ES QUE TIDO LO REKACIINADI CIN KA AKQUIMIA ESCESOTERUSMO Y ESO NO VIEBE PRECISAMENTE DE ELOHIM YHWH
    UN FUERTE ABRAZO
    LKM
    BENDICIONES
    MARANATHA

    1. Al-Wali

      Esta cuerda es del zapato del que está detrás de la marioneta, Yosef.

        1. Yosef Arad

          UNA VEZ MAS RESPETO TU OPINIÓN PERO NO LA COMPARTO ARTURO
          BENDICIONES

          1. Al-Wali

            Lo sé, Yosef.

    1. Yosef Arad

      GRACIAS ZACK
      PUES SI FUE IKEGAL PIRQUE AL FIBAL SE DEMOSTRÓ LA INEXISTENCIA DE ARMAS DE DESTRUCCIÓN MASIVA QUE FYE EK «CASUS BELKU» OFICIAL.
      EL VERDADERO FUERON LAS INGENTES RESERVAS DE PETROLEO IRAQUI Y ALGO QYE CASI TODO EL MUNDO DESCONOXE:
      LOS VESTIGIOS ARQUEOLÓGICOS SUMERIOS DEL MUSEO DE BAGDAD.
      BENDICIONES

  24. Abel Real

    BENDICIONES HERMANOS, GRACIAS POR TODAS LAS INFORMACIONES, HOY OS TRAIGO UN VIDEO DE LA EMET DE YAWE, ANTES QUERIA DECIR QUE ESTE FIN DE SEMANA, DEVIDO A LAS ALTAS TEMPERATURAS, TODOS LOS CEREALES HAN SUFRIDO MUCHO Y PODEMOS DAR POR PERDIDA LA COSECHA ENTRE UN 30 Y UN 60%
    SI OS FIJAIS EN EL COLOR DE LA COSECHA DESDE LA CARRETERA A PASADO A SER DE COLOR BLANCO O CLARO, ESTE HECHO OCURRE CUANDO LA COSECHA SE QUEMA POR SEQUIA Y ALTAS TEMPERATURAS….
    EN MI HUERTO PUSE MALLA DE SOMBREO PARA TODAS LAS PLANTAS, CREO QUE SE HAN SALVADO…
    EN FIN, YA SABEMOS QUE VAN A OCURRIR MUCHAS MAS COSAS… DIOS TENGA PIEDAD, BENDICIONES HERMANOS, LKM, MARANATHA!
    https://youtu.be/Cq0ILLh6F4M

    1. Yosef Arad

      QUERIDO ABEL
      ACABO DE VER EL VIDEO SOBRE NEOM LA CIBERCIYDAD DE ARABIA SAUDI Y SU RELACIÓN CON LA SAGA DE PELÍCULAS DE «MATRIX».
      ES SIMPLEMENTE IMPRESIONANTE Y ME QUEDO CORTO.
      HAY UN PRIMADO NEGATIVO QUE ES ORO PURO DE LA SIMBOLOGIA DE KA PELUCULA Y SU REFERENCIA EXPLÍCITA AL ISL@M .
      UNO DE LOS MEJORES VIDEOS QUE GE VISTO SIBRE ESTEVTENA
      ENHORABUENA OTRA VEZ HERMANO
      LKM
      BENDICIONES
      MARANATHA

  25. Yosef Arad

    GRACIAS QUERIDO HERMANO ABEL
    ENHORABUENA POR LA PREVISIÓN Y JABILIDAF QUE SIN DUDA TE HA OTORGADO ELOHIM YHWH EN ARAS A LA CONSERVACION DE TU PLANTACIÓN.
    AQUI VIDEO SOBRE EL ESTRECHO «PARTNERSHIP» ENTRE PUT1N Y VIL PUERT@$
    https://youtu.be/-mhuh3vyl7U
    LKM
    BENDICIONES
    MARANATHA

Deja una respuesta